Metabolic Syndrome Problematic After Liver Transplant
By Crystal Phend, Senior Staff Writer, MedPage Today
Published: November 27, 2009
Reviewed by Zalman S. Agus, MD; Emeritus Professor
University of Pennsylvania School of Medicine and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner Earn CME/CE credit
for reading medical news
Action Points
Metabolic syndrome is an "epidemic waiting to happen" among liver transplant recipients, largely as a result of their increasing likelihood of survival, a review shows.
Post-transplant metabolic syndrome prevalence was 43% to 58% after 12 to 18 months, compared with 24% in the general population, according to Arthur J. McCullough, MD, of the Cleveland Clinic, and colleagues.
The consequences also appeared more serious in liver transplant recipients, they reported online ahead of print in the December issue of Liver Transplantation.
After transplantation, patients were at a 3.07-fold (95% confidence interval 1.98 to 4.53) higher risk of cardiovascular and ischemic events than age- and sex-matched controls, according to one study consulted in the systematic review.
Transplant recipients who developed metabolic syndrome were at particular cardiovascular event risk compared with those who didn't (rate 30% versus 8%, P=0.003).
Although there is controversy over the impact of post-transplant metabolic syndrome on overall survival, the researchers noted that the same study showed 2.5 times (95% CI 1.52 to 4.05) higher relative risk of cardiovascular death in the transplant group.
There was also a significantly elevated risk of rejection and all types of infections after transplantation for those who developed metabolic syndrome.
Immunosuppressants appear to be largely to blame for the elevated risk of metabolic syndrome after liver transplantation, the investigators said.
Use of tacrolimus (Prograf)-based regimens instead of cyclosporine could help reduce metabolic syndrome risk after transplantation, as could use of lipid-lowering agents, optimal blood glucose control, and lifestyle measures, McCullough's group said.
Even before transplantation, patients should be carefully screened for diabetes, dyslipidemia, and obesity, they wrote, adding, "It is important to reiterate the importance of weight reduction before and after transplantation with a carefully constructed program including diet modification and exercise."
Dyslipidemia is a well recognized complication of liver transplantation and is also a component of the metabolic syndrome. With five-year transplant survival rates now over 70%, this problem is being increasingly recognized, the reviewers said.
In addition to overall higher metabolic syndrome rates after liver transplant, individual components of the syndrome appear more common as well. Prevalence rates at 18 months in one study were:
* 61% for diabetes after transplant compared with 13% before
* 46% for dyslipidemia, with 3% before
* 62% for hypertension, versus 10% before
Compared with general population or matched control groups, other studies have shown a 5.99 (95% CI 4.15 to 2.38) times higher prevalence of post-transplant diabetes, 3.07-fold (95% CI 2.35 to 3.93) higher prevalence of hypertension, and higher body mass index (P=0.04).
Insulin resistance, while nearly universal in patients with cirrhosis before transplantation, typically improves after transplantation significantly. But one study suggested that 41% of patients who have received a donor liver remain insulin resistant.
"It should be noted that any improvement in sensitivity post-transplant occurs despite the presence of immunosuppressive therapy, which may adversely affect insulin resistance," McCullough's group wrote.
"It is likely that this improved insulin sensitivity post-transplant is a result of an increase in peripheral glucose utilization and the correction of insulin resistance in the periphery," they added.
Differences noted between cyclosporine and tacrolimus-based regimens might have been, in part, due to the latter's steroid-sparing effect, the investigators said.
Predictors of post-transplant metabolic syndrome include higher age at transplant; rising BMI after transplant; preexisting diabetes; a history of smoking; certain immunosuppressant regimens, such as cyclosporine; and hepatitis C, alcohol, or cryptogenic cirrhosis as the indication for transplant.
The researchers provided no information on conflicts of interest.
Primary source: Liver Transplantation
Source reference:
Pagadala M, et al "Posttransplant metabolic syndrome: An epidemic waiting to happen" Liver Transpl 2009; 15: 1662-70.
Monday, November 30, 2009
What is liver cancer (hepatocellular carcinoma, HCC)?
What is liver cancer (hepatocellular carcinoma, HCC)?
Liver cancer (hepatocellular carcinoma) is a cancer arising from the liver. It is also known as primary liver cancer or hepatoma. The liver is made up of different cell types (for example, bile ducts, blood vessels, and fat-storing cells). However, liver cells (hepatocytes) make up 80% of the liver tissue. Thus, the majority of primary liver cancers (over 90 to 95%) arises from liver cells and is called hepatocellular cancer or carcinoma.
When patients or physicians speak of liver cancer, however, they are often referring to cancer that has spread to the liver, having originated in other organs (such as the colon, stomach, pancreas, breast, and lung). More specifically, this type of liver cancer is called metastatic liver disease (cancer) or secondary liver cancer. Thus, the term liver cancer actually can refer to either metastatic liver cancer or hepatocellular cancer. The subject of this article is hepatocellular carcinoma, which I will refer to as liver cancer.
What is the scope of the liver cancer problem?
Liver cancer is the fifth most common cancer in the world. A deadly cancer, liver cancer will kill almost all patients who have it within a year. In 1990, the World Health Organization estimated that there were about 430,000 new cases of liver cancer worldwide, and a similar number of patients died as a result of this disease. About three quarters of the cases of liver cancer are found in Southeast Asia (China, Hong Kong, Taiwan, Korea, and Japan). Liver cancer is also very common in sub-Saharan Africa (Mozambique and South Africa).
The frequency of liver cancer in Southeast Asia and sub-Saharan Africa is greater than 20 cases per 100,000 population. In contrast, the frequency of liver cancer in North America and Western Europe is much lower, less than five per 100,000 population. However, the frequency of liver cancer among native Alaskans is comparable to that seen in Southeast Asia. Moreover, recent data show that the frequency of liver cancer in the U.S. overall is rising. This increase is due primarily to chronic hepatitis C, an infection of the liver that causes liver cancer.
Hepatocellular Carcinoma
(Liver Cancer)
Pictures of Pancreatic Cancer
Pancreatic Cancer Slideshow
View Pancreatic Cancer Slideshow
Medical Author: Tse-Ling Fong, MD
Medical Editor: Leslie J. Schoenfield, MD, PhD
* What is liver cancer (hepatocellular carcinoma, HCC)?
* What is the scope of the liver cancer problem?
* What are the population characteristics (epidemiology) of liver cancer?
* What are the risk factors for liver cancer?
* What are the symptoms of liver cancer?
* How is liver cancer diagnosed?
o Blood tests
o Imaging studies
o Liver biopsy or aspiration
o Patient Discussions: Liver Cancer - Describe Your Experience
* What is the natural history of liver cancer?
* What are the treatment options for liver cancer?
o Chemotherapy
o Chemoembolization (trans-arterial chemoembolization or TACE)
o Ablation techniques
o Proton beam therapy
o Surgery
* Is there a role for routine screening for liver cancer?
* What is fibrolamellar carcinoma?
* What's in the future for the prevention and treatment of liver cancer?
* Liver Cancer At a Glance
* Related liver cancer articles:
Liver cancer - on WebMD
Liver cancer (hepatocellular carcinoma) is a cancer arising from the liver. It is also known as primary liver cancer or hepatoma. The liver is made up of different cell types (for example, bile ducts, blood vessels, and fat-storing cells). However, liver cells (hepatocytes) make up 80% of the liver tissue. Thus, the majority of primary liver cancers (over 90 to 95%) arises from liver cells and is called hepatocellular cancer or carcinoma.
When patients or physicians speak of liver cancer, however, they are often referring to cancer that has spread to the liver, having originated in other organs (such as the colon, stomach, pancreas, breast, and lung). More specifically, this type of liver cancer is called metastatic liver disease (cancer) or secondary liver cancer. Thus, the term liver cancer actually can refer to either metastatic liver cancer or hepatocellular cancer. The subject of this article is hepatocellular carcinoma, which I will refer to as liver cancer.
What is the scope of the liver cancer problem?
Liver cancer is the fifth most common cancer in the world. A deadly cancer, liver cancer will kill almost all patients who have it within a year. In 1990, the World Health Organization estimated that there were about 430,000 new cases of liver cancer worldwide, and a similar number of patients died as a result of this disease. About three quarters of the cases of liver cancer are found in Southeast Asia (China, Hong Kong, Taiwan, Korea, and Japan). Liver cancer is also very common in sub-Saharan Africa (Mozambique and South Africa).
The frequency of liver cancer in Southeast Asia and sub-Saharan Africa is greater than 20 cases per 100,000 population. In contrast, the frequency of liver cancer in North America and Western Europe is much lower, less than five per 100,000 population. However, the frequency of liver cancer among native Alaskans is comparable to that seen in Southeast Asia. Moreover, recent data show that the frequency of liver cancer in the U.S. overall is rising. This increase is due primarily to chronic hepatitis C, an infection of the liver that causes liver cancer.
Hepatocellular Carcinoma
(Liver Cancer)
Pictures of Pancreatic Cancer
Pancreatic Cancer Slideshow
View Pancreatic Cancer Slideshow
Medical Author: Tse-Ling Fong, MD
Medical Editor: Leslie J. Schoenfield, MD, PhD
* What is liver cancer (hepatocellular carcinoma, HCC)?
* What is the scope of the liver cancer problem?
* What are the population characteristics (epidemiology) of liver cancer?
* What are the risk factors for liver cancer?
* What are the symptoms of liver cancer?
* How is liver cancer diagnosed?
o Blood tests
o Imaging studies
o Liver biopsy or aspiration
o Patient Discussions: Liver Cancer - Describe Your Experience
* What is the natural history of liver cancer?
* What are the treatment options for liver cancer?
o Chemotherapy
o Chemoembolization (trans-arterial chemoembolization or TACE)
o Ablation techniques
o Proton beam therapy
o Surgery
* Is there a role for routine screening for liver cancer?
* What is fibrolamellar carcinoma?
* What's in the future for the prevention and treatment of liver cancer?
* Liver Cancer At a Glance
* Related liver cancer articles:
Liver cancer - on WebMD
What Is Cirrhosis? What Causes Cirrhosis?
What Is Cirrhosis? What Causes Cirrhosis?
Article Date: 26 Nov 2009 - 5:00 PST
Cirrhosis is an abnormal liver condition in which there is irreversible scarring of the liver. The main causes are sustained excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are many possible causes.
People with cirrhosis may develop jaundice (yellowing of the skin, eyes and tongue), itching and extreme tiredness.
For cirrhosis to develop long-term, continuous damage to the liver needs to occur. When healthy liver tissue is destroyed and replaced by scar tissue the condition becomes serious, as it can start blocking the flow of blood through the liver.
Cirrhosis is a progressive disease, developing slowly over many years, until eventually it can stop liver function (liver failure).
The liver carries out several essential functions, including the detoxification of harmful substances in the body. It also purifies the blood and manufactures vital nutrients.
If cirrhosis is mild the liver can make repairs and continue functioning properly. If the cirrhosis is advanced and more and more scar tissue forms in the liver, the damage is irreparable. The liver tissue is replaced by fibrous scar tissue as well as regenerative nodules (lumps that appear as a consequence of a process in which damaged tissue is regenerated).
According to Medilexicon's medical dictionary:
Cirrhosis is "A chronic liver disease of highly various etiology characterized by inflammation, degeneration, and regeneration in differing proportions; pathologic hallmark is formation of microscopic or macroscopic nodules separated by bands of fibrous tissue; impairment of hepatocellular function and obstruction to portal circulation often lead to jaundice, ascites, and hepatic failure."
What are the signs and symptoms of cirrhosis?
A symptom is something the patient feels and reports, while a sign is something other people, including a doctor or a nurse may detect. For example, pain may be a symptom while a rash may be a sign.
Symptoms are not common during the early stages of cirrhosis. However, as scar tissue accumulates the liver's ability to function properly is undermined. The following signs and symptoms may occur:
* Blood capillaries become visible on the skin on the upper abdomen
* Fatigue
* Insomnia
* Itchy skin
* Loss of appetite
* Loss of bodyweight
* Nausea
* Pain or tenderness in the area where the liver is located
* Red or blotchy palms
* Weakness
The following signs and symptoms may appear as the disease progresses:
* Abdomen fills up with fluid, giving the patient a large tummy (ascites)
* Accelerated heartbeat
* Altered personality (as blood toxins build up and affect the brain)
* Bleeding gums
* Body and upper arms lose mass
* Body finds it harder to process alcohol
* Body finds it harder to process drugs
* Confusion
* Dizziness
* Fluid buildup on ankles, feet and legs (edema)
* Hair loss
* Higher susceptibility to bruising
* Jaundice (yellowing of the skin, whites of the eyes, and tongue)
* Loss of libido (sex drive)
* Memory problems
* More frequent fevers (susceptibility to infections)
* Muscle cramps
* Nosebleeds
* Pain on the right shoulder
* Panting (breathlessness)
* Stools become black and tarry, or very pale
* Urine becomes darker
* Vomiting blood
* Walking problems (staggering)
What are the causes of cirrhosis?
The most common causes of cirrhosis are long-term alcohol abuse, hepatitis B and C infection, and fatty liver disease.
Overconsumption of alcohol
According to the NHS (National Health Service), UK, excessive alcohol consumption is when a man drinks more than 21 units and a woman drinks more than 14 units per week.
Toxins, including alcohol, are broken down by the liver. However, if the amount of alcohol is too high the liver will be overworked and liver cells can eventually become damaged.
Heavy, regular, long-term drinkers are much more likely to develop cirrhosis, compared to other healthy people. It is a myth that only alcoholics are at risk - regular and heavy social drinking is also linked to a higher probability of developing cirrhosis.
Typically, heavy drinking needs to be sustained for at least ten years for cirrhosis to develop. The period varies according to each individual.
Regular heavy female drinkers are more likely to develop symptoms compared to men who consume the same amount.
Heavy drinkers will eventually develop fatty liver. The liver breaks down alcohol into carbon dioxide and water, causing fatty liver. As soon as excessive drinking stops the symptoms of fatty liver go away. However, 20% to 30% of those who continue drinking heavily will develop alcoholic hepatitis, the next stage. Approximately 10% of heavy drinkers will subsequently develop cirrhosis - the third stage of alcoholic liver disease.
Health authorities in the UK urge males not to exceed three to four units of alcohol consumption per day, and women should not have more than two to three units daily - to reduce the risk of developing alcohol hepatitis and cirrhosis.
Hepatitis and cirrhosis
Hepatitis C, a bloodborne infection, can damage the liver and eventually lead to cirrhosis. Hepatitis C is a common cause of cirrhosis in Western Europe, North America, and many other parts of the world. Cirrhosis can also be caused by hepatitis B and D.
Non-alcoholic steatohepatitis (NASH)
NASH is more likely to occur with people who are obese, diabetes patients, those with high blood lipid (fat) levels, as well as individuals with hypertension (high blood pressure). NASH, in its early stages, begins with the accumulation of too much fat in the liver. The fat causes inflammation and scarring, resulting in possible cirrhosis later on.
Autoimmune hepatitis
The person's own immune system attacks healthy organs in the body as though they were foreign substances. Sometimes the liver is attacked. Eventually the patient can develop cirrhosis.
Some genetic conditions
* Hemochromatosis - iron accumulates in the liver and other parts of the body.
* Wilson's disease - copper accumulates in the liver and other parts of the body.
Blockage of bile ducts
Some conditions and diseases, such as cancer of the bile ducts, or cancer of the pancreas can block the bile ducts, increasing the risk of cirrhosis.
Budd-Chiari syndrome
There is thrombosis (blood clots) in the hepatic vein, the blood vessel that carries blood from the liver, leading to liver enlargement and the development of collateral vessels.
Some other diseases and conditions
* Cystic fibrosis
* Primary sclerosing cholangitis - hardening and scarring of the bile ducts
* Galactosemia - inability to process sugars in milk
* Schistosomiasis - a parasite commonly found in some developing countries
* Biliary atresia - badly formed bile ducts in babies
* Glycogen storage disease - problems in the storage and energy release vital for cell function
Diagnosis of cirrhosis
Cirrhosis in its early stages is often diagnosed when the patient is being tested for some other condition or disease because symptoms are not present.
Anybody who has the following symptoms should see their doctor immediately:
* Fever with shivering
* Panting (shortness of breath)
* Vomiting blood
* Dark stools, or tarry stools (as if covered with tar)
* Episodes of drowsiness or confusion
A GP (general practitioner, primary care physician) will examine the patient and feel around the liver area to determine whether it is enlarged. The patient will be asked about his/her medical history and lifestyle (drinking, etc).
The following tests may also be ordered:
A blood test - to measure how well the liver is functioning and determine whether there is any damage. If levels of ALT (alanine transaminase) are high the patient may have hepatitis.
Imaging tests - this may involve an ultrasound, CT (computerized tomography), or MRI (magnetic resonance imaging) scan of the liver. Apart from seeing whether the liver is enlarged, the doctor will also be able to detect any scarring.
A biopsy - a small sample of liver cells are extracted and examined under a microscope. The doctor inserts a fine needle in between the ribs and into the liver. The patient will receive a local anesthetic. The biopsy not only confirms or rules out cirrhosis, but may also reveal its cause (if it is cirrhosis).
Endoscopy - an endoscope, a long, thin tube with a light and video camera at the end goes down the patient's windpipe (esophagus) and into their stomach. The doctor sees the inside of the stomach on a screen, and looks out for swollen blood vessels (varices); a hallmark sign of cirrhosis.
Child-Pugh Score
Also known as the Child-Turcotte-Pugh score, assesses the prognosis (outlook) of chronic liver disease, mainly cirrhosis. Originally, it was used to predict mortality during surgery, but is now used to determine prognosis, as well as the required treatment strength, and whether or not the patient needs a liver transplant. It is a combination of numbered points and the letters A, B, C (see below):
Class Points One year survival Two year survival
A 5-6 100% 85%
B 7-9 81% 57%
C 10-15 45% 35%
What are the treatment options for cirrhosis?
If the cirrhosis is diagnosed early enough, damage may be minimized by treating its underlying cause.
Alcohol dependency (alcoholism) treatment - it is important for the patient to stop drinking if their cirrhosis was caused by long-term, regular heavy alcohol consumption. In many cases the doctor will recommend a treatment program foralcoholism.
Medications - the patient may be prescribed drugs to control liver cell damage caused by hepatitis B or C.
Treating cirrhosis complications
Ascites or edema - ascites (accumulation of fluid in the abdomen) or edema (fluid retention in the legs) can be treated with a low-sodium (salt) diet and water pills. In severe cases the fluid may have to be drained. Sometimes surgery is required.
Pressure in the portal vein and collateral smaller veins - hypertension (high blood pressure) drugs are usually prescribed to control the increasing pressure in the blood vessels around the liver; the aim is to prevent severe bleeding. In some cases a stent may be surgically placed in the portal vein to hold it open. Signs of bleeding can be detected via an endoscopy.
Treatment of swollen varices - if the patient vomits blood or passes bloody stools they probably have esophageal varices (in the food pipe). Urgent medical attention is required. The following procedures may help:
* Banding - a small band is placed around the base of the varices to control bleeding. An endoscope gores down the patient's throat and esophagus during the procedure.
* Injection sclerotherapy - after an endoscopy a substance is injected into the varices which triggers a blood clot and scar tissue to form; this helps stem the bleeding.
* A Sengstaken tube with a balloon - the balloon is at the end of the tube. If endoscopy does not stop the bleeding a tube goes down the patient's throat and into their stomach. The balloon is inflated; this places pressure on the varices and stops the bleeding.
* TIPSS (transjugular intrahepatic portosystemic stent shunt) - if the above-mentioned therapies do not stem the bleeding, a stent (metal tube) is passed across the liver to join the portal and hepatic veins, creating a new route for the blood to flow through. This reduces pressure - pressure which was causing the varices.
Infections - the patient will be given antibiotics, and some other treatments.
Screening for liver cancer - patients with cirrhosis have a much higher risk of developing liver cancer. The doctor may recommend regular blood tests and imaging scans.
Hepatic encephalopathy (high blood toxin levels) - drugs can help treat excessive blood toxin levels. The signs and symptoms need to be explained to the patient so that they know what to look out for.
Liver transplant - if the cirrhosis is advanced and there is liver failure (liver does not function) the patient may need a liver transplant.
Prevention of cirrhosis
Alcohol - do not exceed the recommended daily/weekly alcohol limit.
* Men: maximum of 21 units per week, or three/four units per day
* Women: maximum of 14 units per week, or two/three units per day
Individuals who have cirrhosis should abstain from alcohol completely. Alcohol accelerates the progression of the disease.
Hepatitis B and C
* Use a condom when having sex
* Do not share needles when injecting drugs
* People at risk of becoming infected with hepatitis B, such as health care workers, social care workers, and police personnel can be vaccinated (there is currently no vaccine for hepatitis C)
Written by Christian Nordqvist
Copyright: Medical News Today
Article Date: 26 Nov 2009 - 5:00 PST
Cirrhosis is an abnormal liver condition in which there is irreversible scarring of the liver. The main causes are sustained excessive alcohol consumption, viral hepatitis B and C, and fatty liver disease - however, there are many possible causes.
People with cirrhosis may develop jaundice (yellowing of the skin, eyes and tongue), itching and extreme tiredness.
For cirrhosis to develop long-term, continuous damage to the liver needs to occur. When healthy liver tissue is destroyed and replaced by scar tissue the condition becomes serious, as it can start blocking the flow of blood through the liver.
Cirrhosis is a progressive disease, developing slowly over many years, until eventually it can stop liver function (liver failure).
The liver carries out several essential functions, including the detoxification of harmful substances in the body. It also purifies the blood and manufactures vital nutrients.
If cirrhosis is mild the liver can make repairs and continue functioning properly. If the cirrhosis is advanced and more and more scar tissue forms in the liver, the damage is irreparable. The liver tissue is replaced by fibrous scar tissue as well as regenerative nodules (lumps that appear as a consequence of a process in which damaged tissue is regenerated).
According to Medilexicon's medical dictionary:
Cirrhosis is "A chronic liver disease of highly various etiology characterized by inflammation, degeneration, and regeneration in differing proportions; pathologic hallmark is formation of microscopic or macroscopic nodules separated by bands of fibrous tissue; impairment of hepatocellular function and obstruction to portal circulation often lead to jaundice, ascites, and hepatic failure."
What are the signs and symptoms of cirrhosis?
A symptom is something the patient feels and reports, while a sign is something other people, including a doctor or a nurse may detect. For example, pain may be a symptom while a rash may be a sign.
Symptoms are not common during the early stages of cirrhosis. However, as scar tissue accumulates the liver's ability to function properly is undermined. The following signs and symptoms may occur:
* Blood capillaries become visible on the skin on the upper abdomen
* Fatigue
* Insomnia
* Itchy skin
* Loss of appetite
* Loss of bodyweight
* Nausea
* Pain or tenderness in the area where the liver is located
* Red or blotchy palms
* Weakness
The following signs and symptoms may appear as the disease progresses:
* Abdomen fills up with fluid, giving the patient a large tummy (ascites)
* Accelerated heartbeat
* Altered personality (as blood toxins build up and affect the brain)
* Bleeding gums
* Body and upper arms lose mass
* Body finds it harder to process alcohol
* Body finds it harder to process drugs
* Confusion
* Dizziness
* Fluid buildup on ankles, feet and legs (edema)
* Hair loss
* Higher susceptibility to bruising
* Jaundice (yellowing of the skin, whites of the eyes, and tongue)
* Loss of libido (sex drive)
* Memory problems
* More frequent fevers (susceptibility to infections)
* Muscle cramps
* Nosebleeds
* Pain on the right shoulder
* Panting (breathlessness)
* Stools become black and tarry, or very pale
* Urine becomes darker
* Vomiting blood
* Walking problems (staggering)
What are the causes of cirrhosis?
The most common causes of cirrhosis are long-term alcohol abuse, hepatitis B and C infection, and fatty liver disease.
Overconsumption of alcohol
According to the NHS (National Health Service), UK, excessive alcohol consumption is when a man drinks more than 21 units and a woman drinks more than 14 units per week.
Toxins, including alcohol, are broken down by the liver. However, if the amount of alcohol is too high the liver will be overworked and liver cells can eventually become damaged.
Heavy, regular, long-term drinkers are much more likely to develop cirrhosis, compared to other healthy people. It is a myth that only alcoholics are at risk - regular and heavy social drinking is also linked to a higher probability of developing cirrhosis.
Typically, heavy drinking needs to be sustained for at least ten years for cirrhosis to develop. The period varies according to each individual.
Regular heavy female drinkers are more likely to develop symptoms compared to men who consume the same amount.
Heavy drinkers will eventually develop fatty liver. The liver breaks down alcohol into carbon dioxide and water, causing fatty liver. As soon as excessive drinking stops the symptoms of fatty liver go away. However, 20% to 30% of those who continue drinking heavily will develop alcoholic hepatitis, the next stage. Approximately 10% of heavy drinkers will subsequently develop cirrhosis - the third stage of alcoholic liver disease.
Health authorities in the UK urge males not to exceed three to four units of alcohol consumption per day, and women should not have more than two to three units daily - to reduce the risk of developing alcohol hepatitis and cirrhosis.
Hepatitis and cirrhosis
Hepatitis C, a bloodborne infection, can damage the liver and eventually lead to cirrhosis. Hepatitis C is a common cause of cirrhosis in Western Europe, North America, and many other parts of the world. Cirrhosis can also be caused by hepatitis B and D.
Non-alcoholic steatohepatitis (NASH)
NASH is more likely to occur with people who are obese, diabetes patients, those with high blood lipid (fat) levels, as well as individuals with hypertension (high blood pressure). NASH, in its early stages, begins with the accumulation of too much fat in the liver. The fat causes inflammation and scarring, resulting in possible cirrhosis later on.
Autoimmune hepatitis
The person's own immune system attacks healthy organs in the body as though they were foreign substances. Sometimes the liver is attacked. Eventually the patient can develop cirrhosis.
Some genetic conditions
* Hemochromatosis - iron accumulates in the liver and other parts of the body.
* Wilson's disease - copper accumulates in the liver and other parts of the body.
Blockage of bile ducts
Some conditions and diseases, such as cancer of the bile ducts, or cancer of the pancreas can block the bile ducts, increasing the risk of cirrhosis.
Budd-Chiari syndrome
There is thrombosis (blood clots) in the hepatic vein, the blood vessel that carries blood from the liver, leading to liver enlargement and the development of collateral vessels.
Some other diseases and conditions
* Cystic fibrosis
* Primary sclerosing cholangitis - hardening and scarring of the bile ducts
* Galactosemia - inability to process sugars in milk
* Schistosomiasis - a parasite commonly found in some developing countries
* Biliary atresia - badly formed bile ducts in babies
* Glycogen storage disease - problems in the storage and energy release vital for cell function
Diagnosis of cirrhosis
Cirrhosis in its early stages is often diagnosed when the patient is being tested for some other condition or disease because symptoms are not present.
Anybody who has the following symptoms should see their doctor immediately:
* Fever with shivering
* Panting (shortness of breath)
* Vomiting blood
* Dark stools, or tarry stools (as if covered with tar)
* Episodes of drowsiness or confusion
A GP (general practitioner, primary care physician) will examine the patient and feel around the liver area to determine whether it is enlarged. The patient will be asked about his/her medical history and lifestyle (drinking, etc).
The following tests may also be ordered:
A blood test - to measure how well the liver is functioning and determine whether there is any damage. If levels of ALT (alanine transaminase) are high the patient may have hepatitis.
Imaging tests - this may involve an ultrasound, CT (computerized tomography), or MRI (magnetic resonance imaging) scan of the liver. Apart from seeing whether the liver is enlarged, the doctor will also be able to detect any scarring.
A biopsy - a small sample of liver cells are extracted and examined under a microscope. The doctor inserts a fine needle in between the ribs and into the liver. The patient will receive a local anesthetic. The biopsy not only confirms or rules out cirrhosis, but may also reveal its cause (if it is cirrhosis).
Endoscopy - an endoscope, a long, thin tube with a light and video camera at the end goes down the patient's windpipe (esophagus) and into their stomach. The doctor sees the inside of the stomach on a screen, and looks out for swollen blood vessels (varices); a hallmark sign of cirrhosis.
Child-Pugh Score
Also known as the Child-Turcotte-Pugh score, assesses the prognosis (outlook) of chronic liver disease, mainly cirrhosis. Originally, it was used to predict mortality during surgery, but is now used to determine prognosis, as well as the required treatment strength, and whether or not the patient needs a liver transplant. It is a combination of numbered points and the letters A, B, C (see below):
Class Points One year survival Two year survival
A 5-6 100% 85%
B 7-9 81% 57%
C 10-15 45% 35%
What are the treatment options for cirrhosis?
If the cirrhosis is diagnosed early enough, damage may be minimized by treating its underlying cause.
Alcohol dependency (alcoholism) treatment - it is important for the patient to stop drinking if their cirrhosis was caused by long-term, regular heavy alcohol consumption. In many cases the doctor will recommend a treatment program foralcoholism.
Medications - the patient may be prescribed drugs to control liver cell damage caused by hepatitis B or C.
Treating cirrhosis complications
Ascites or edema - ascites (accumulation of fluid in the abdomen) or edema (fluid retention in the legs) can be treated with a low-sodium (salt) diet and water pills. In severe cases the fluid may have to be drained. Sometimes surgery is required.
Pressure in the portal vein and collateral smaller veins - hypertension (high blood pressure) drugs are usually prescribed to control the increasing pressure in the blood vessels around the liver; the aim is to prevent severe bleeding. In some cases a stent may be surgically placed in the portal vein to hold it open. Signs of bleeding can be detected via an endoscopy.
Treatment of swollen varices - if the patient vomits blood or passes bloody stools they probably have esophageal varices (in the food pipe). Urgent medical attention is required. The following procedures may help:
* Banding - a small band is placed around the base of the varices to control bleeding. An endoscope gores down the patient's throat and esophagus during the procedure.
* Injection sclerotherapy - after an endoscopy a substance is injected into the varices which triggers a blood clot and scar tissue to form; this helps stem the bleeding.
* A Sengstaken tube with a balloon - the balloon is at the end of the tube. If endoscopy does not stop the bleeding a tube goes down the patient's throat and into their stomach. The balloon is inflated; this places pressure on the varices and stops the bleeding.
* TIPSS (transjugular intrahepatic portosystemic stent shunt) - if the above-mentioned therapies do not stem the bleeding, a stent (metal tube) is passed across the liver to join the portal and hepatic veins, creating a new route for the blood to flow through. This reduces pressure - pressure which was causing the varices.
Infections - the patient will be given antibiotics, and some other treatments.
Screening for liver cancer - patients with cirrhosis have a much higher risk of developing liver cancer. The doctor may recommend regular blood tests and imaging scans.
Hepatic encephalopathy (high blood toxin levels) - drugs can help treat excessive blood toxin levels. The signs and symptoms need to be explained to the patient so that they know what to look out for.
Liver transplant - if the cirrhosis is advanced and there is liver failure (liver does not function) the patient may need a liver transplant.
Prevention of cirrhosis
Alcohol - do not exceed the recommended daily/weekly alcohol limit.
* Men: maximum of 21 units per week, or three/four units per day
* Women: maximum of 14 units per week, or two/three units per day
Individuals who have cirrhosis should abstain from alcohol completely. Alcohol accelerates the progression of the disease.
Hepatitis B and C
* Use a condom when having sex
* Do not share needles when injecting drugs
* People at risk of becoming infected with hepatitis B, such as health care workers, social care workers, and police personnel can be vaccinated (there is currently no vaccine for hepatitis C)
Written by Christian Nordqvist
Copyright: Medical News Today
Pharmasset Reports Fiscal Year End 2009 Financial Results
Pharmasset Reports Fiscal Year End 2009 Financial Results
PRINCETON, N.J., Nov 25, 2009 /PRNewswire-FirstCall via COMTEX News Network/ -- Pharmasset, Inc. (Nasdaq: VRUS), a clinical stage pharmaceutical company committed to discovering, developing and commercializing novel drugs to treat viral infections, reported financial results for the fiscal year ended September 30, 2009. At September 30, 2009 Pharmass et held $58.4 million in cash, cash equivalents and short term investments.
Pipeline Update and 2009 Highlights
RG7128
Phase 2b Trial
In late November 2009, an independent Data Monitoring Committee (DMC) reviewed the safety and efficacy data from the first approximately 100 patients in cohort 1 and concluded that based on these data the remaining approximately 300 patients can be safely enrolled in the phase 2b study. The DMC reviewed any potential drug discontinuations, incidence and details of adverse events, and selected laboratory assessments. No safety events in the DMC review were considered significantly different from those expected from HCV patients taking peginterferon and ribavirin treatment. The DMC did not recommend modification of dose or duration of any RG7128 dosing regimens. Enrollment of these patients pre-screened for this cohort in the fourth quarter of 2009 has begun and is expected to be complete by the end of the first quarter of 2010.
This phase 2b trial is anti cipated to enroll approximately 400 treatment-naive, genotype-1 or genotype-4 HCV-infected patients. The five arm trial, initiated in April 2009, is evaluating the dose and duration of RG7128 in combination with peginterferon plus ribavirin. The primary efficacy endpoint of the trial is the proportion of patients that achieve a sustained virologic response (SVR).
In the first quarter 2010, Roche plans to initiate longer duration, phase 2b studies with RG7128 in combination with peginterferon and ribavirin. An additional study in patients infected with HCV genotypes 2 and 3 is being planned to initiate later in 2010.
INFORM-1 Trial
In November 2008, Roche initiated the INFORM-1 trial, a ground-breaking study to investigate the activity of a combination of two oral antiviral molecules in the absence of interferon and ribavirin. The study investigated the combination of Pharmasset's RG7128 with InterMune's RG7227, an HCV protease inhibitor.
In Ap ril 2009, Pharmasset, Roche and InterMune reported interim results from this study at the European Association for the Study of the Liver (EASL) in Copenhagen, Denmark. These interim results demonstrated for the first time that the combination of an oral protease inhibitor and an oral nucleoside polymerase inhibitor resulted in significant HCV viral load reduction in patients with HCV over 13 days of dosing of the combination of RG7227 and RG7128 (without peginterferon or ribavirin). No treatment-related serious adverse events, no dose reductions and no discontinuations were reported during the study. Pharmacokinetic analysis confirmed that there were no drug-drug interactions between the compounds.
Roche expects to initiate a Phase 2 program of multiple INFORM studies during the first calendar quarter of 2010. Roche expects these INFORM-2 studies to investigate rapid virologic response (RVR) achieved by twice-daily dosing of RG7128 and RG7227 alone, in combination wit h peginterferon, in combination with ribavirin, or in combination wi th both peginterferon and ribavirin. Roche expects to initiate longer term studies evaluating SVR during the first half of 2010.
PSI-7851
PSI-7851 is a pro-drug of a pyrimidine nucleotide analog polymerase inhibitor and is currently in development for the treatment of chronic HCV infection. During March 2009, we initiated a Phase 1 study for PSI-7851. A single ascending dose study was conducted that assessed the safety, tolerability and pharmacokinetics of PSI-7851 in healthy subjects at doses ranging from 25mg to 800mg. PSI-7851 was found to be generally safe and well tolerated and, therefore, was advanced into a multiple ascending dose trial.
In June 2009, we initiated a phase 1 multiple ascending dose (MAD) study in HCV-infected patients. Subjects were enrolled at two U.S. centers and randomized to PSI-7851 (8 per cohort) or placebo (2 per cohort) . Final results from the MAD study were presented in a late breaker poster at AASLD on November 2, 2009. In the MAD study, PSI-7851 was generally safe and well tolerated across all cohorts with no discontinuations, no serious adverse events, and no dose-related trends in adverse events or laboratory abnormalities. Further, PSI-7851 demonstrated dose-dependent potent antiviral activity with a maximum mean HCV RNA decrease of 1.95 log10 IU/mL in patients receiving 50mg QD, 100mg QD, 200mg QD and 400mg QD administered for 3 days.
PSI-938 and PSI-879
During 2009, we nominated two development candidates from our purine nucleotide analog polymerase inhibitor program for the treatment of chronic HCV. In June 2009, we nominated PSI-938 for further pre-clinical development required for an application with the FDA or equivalent foreign regulatory agency to begin clinical studies. Our plan is to submit an IND, or its foreign equivalent, during the first calendar qu arter of 2010.
In September 2009, we nominated a second purine nucleotide analog, PSI-879, for pre-clinical development. PSI-879 differs from PSI-938 in the prodrug technology that it employs. We anticipate filing an IND, or its foreign equivalent, for PSI-879 in the fourth quarter of 2010.
Termination of Clevudine Registration Trials
On April 20, 2009, following consultations with our independent Data Safety Monitoring Board and the FDA, we voluntarily terminated our phase 3 studies of clevudine after we became aware of a number of spontaneous Serious Adverse Event reports and Events of Special Interest in patients receiving clevudine as prescribed therapy for HBV in South Korea, where the drug is marketed by Bukwang under the trade name Levovir, and in Hong Kong, where clinical studies were being conducted under the sponsorship of Bukwang. Given the number and severity of cases observed in South Korea and Hong Kong, we determined it was in the best interest of patients to voluntarily terminate our registration stu dies. All patients have now completed the follow-up period and we anticipate concluding activities by the end of the quarter ending December 31, 2009.
"Pharmasset has had a tremendous year on all fronts," said Schaefer Price, Pharmasset's President and CEO. "In collaboration with Roche, we are advancing our first in class nucleoside analog, RG7128, through a phase 2b trial and also exploring the paradigm-changing model of an all oral (interferon sparing) regimen for HCV. We reported best in class results with our second generation nucleotide analog inhibitor, PSI-7851 and anticipate starting phase 2a trials in the first quarter 2010. We believe nucleosides/tides will have an advantage in the marketplace when used with the current standard of care, due to their high RVR rates, pan-genotype activity and high barrier to resistance. In the future, as we move towards oral combinations, we believe our nucleoside/tides have the potential to be used in combination with one ano ther and with other classes of direct acting antivirals."
Financial Results
For the fiscal year ended September 30, 2009 Pharmasset reported revenues of $13.3 million, compared with revenues of $1.9 million for the fiscal year 2008. The receipt of a $10.0 million milestone from Roche for the initiation of the phase 2b study with RG7128 led to higher reported revenues in the fiscal year 2009.
Total costs and expenses for the fiscal year ended September 30, 2009 were $65.9 million, of which $26.7 million was associated with clevudine. This compares to $56.3 million for the same period in 2008, of which $26.5 million was related to clevudine. The increased operating expenses for fiscal year 2009 were primarily the result of an increase in preclinical and clinical trial expenses for PSI-7851 for the treatment of chronic HCV infection.
Pharmasset reported a net loss attributable to common stockholders of $55.6 million, or $2.10 per share, as compared to a net loss attributable to common stockholders of $54.7 millio n, or $2.51 per share for the same period in 2008.
Calendar Year 2010 Anticipated Milestones
-- Roche anticipates completion of enrollment for Cohort 2 in the RG7128 phase 2b trial by the end of first quarter of 2010
-- We expect to initiate phase 2a trial with PSI-7851 in the first quarter of 2010 with interim data in the third quarter 2010
-- Roche expects to initiate INFORM-2 in first quarter 2010
-- We expect to file an IND for PSI-938 in first quarter of 2010
-- Roche expects to initiate longer duration, phase 2b studies with RG7128 in combination with pegylated interferon and ribavirin in first half of 2010
-- Roche expects to initiate longer duration INFORM studies to investigate SVR in the first half of 2010
-- We expect to initiate phase 1 trial with PSI-938 in first quarter of 2010 with interim data in the third quarter 2010
-- Roche expects to initiate a phase 2 study in genotype 2 and 3 HCV patients w ith RG7128 in the second half of 2010
-- We expect to file an IND for PSI-879 in fourth quarter of 2010
About Pharmasset
Pharmasset is a clinical-stage pharmaceutical company committed to discovering, developing, and commercializing novel drugs to treat viral infections. Pharmasset's primary focus is on the development of oral therapeutics for the treatment of hepatitis C virus (HCV) and, secondarily, on the development of Racivir(TM) for the treatment of human immunodeficiency virus (HIV). Our research and development efforts focus on nucleoside/tide analogs, a class of compounds which act as alternative substrates for the viral polymerase thus inhibiting viral replication. We currently have three clinical-stage product candidates. RG7128, a nucleoside analog for chronic HCV infections, is in a Phase 2b clinical trial in combination with Pegasys(R) plus Copegus(R) and is also in INFORM studies, the first series of studies designed to assess the potential of combinations of small molecules without Pegasys(R) and Cop egus(R) to treat chronic HCV. These clinical studies are being conducted through a strategic collaboration with Roche. Our other clinical stage candidates include PSI-7851, an unpartnered, next generation HCV nucleotide analog, which has completed initial Phase 1 clinical studies that provided supportive safety and efficacy data to initiate a Phase 2a trial in 1Q 2010 and Racivir, for the treatment of HIV, which has completed a Phase 2 clinical trial. We have also recently announced the nomination of two purine nucleotide analogs, PSI-938 and PSI-879, for preclinical development.
Pegasys(R) and Copegus(R) are registered trademarks of Roche.
Contact
Richard E. T. Smith, Ph.D.
VP, Investor Relations and Corporate Communications
richard.smith@pharmasset.com
Office: +1 (609) 613-4181
Forward-Looking Statements
Pharmasset "Safe Harbor" Statement under the Private Securities Litigation Reform Act of 1995: Statements in this press release regarding our business that are not historical facts are "forward-looking statements" that involve risks and uncertainties, including, without limitation, the risk that adverse events could cause the cessation or delay of any of the ongoing or planned clinical trials and/or our development of our product candidates, the risk that the results of previously conducted studies involving our product candidates will not be repeated or observed in ongoing or future studies involving our product candidates, the risk that our collaboration with Roche will not continue or will not be successful and the risk that any one or more of our product candidates will not be successfully developed and commercialized. For a discussion of these risks and uncertainties, any of which could cause our actual results to di ffer from those contained in the forward-looking statements, see the section of our Annual Report on Form 10-K for the fiscal year ended September 30, 2009 filed with the Securities and Exchange Commission entitled "Risk Factors" and discussions of potential risks and uncertainties in our subsequent filings with the Securities and Exchange Commission.
PRINCETON, N.J., Nov 25, 2009 /PRNewswire-FirstCall via COMTEX News Network/ -- Pharmasset, Inc. (Nasdaq: VRUS), a clinical stage pharmaceutical company committed to discovering, developing and commercializing novel drugs to treat viral infections, reported financial results for the fiscal year ended September 30, 2009. At September 30, 2009 Pharmass et held $58.4 million in cash, cash equivalents and short term investments.
Pipeline Update and 2009 Highlights
RG7128
Phase 2b Trial
In late November 2009, an independent Data Monitoring Committee (DMC) reviewed the safety and efficacy data from the first approximately 100 patients in cohort 1 and concluded that based on these data the remaining approximately 300 patients can be safely enrolled in the phase 2b study. The DMC reviewed any potential drug discontinuations, incidence and details of adverse events, and selected laboratory assessments. No safety events in the DMC review were considered significantly different from those expected from HCV patients taking peginterferon and ribavirin treatment. The DMC did not recommend modification of dose or duration of any RG7128 dosing regimens. Enrollment of these patients pre-screened for this cohort in the fourth quarter of 2009 has begun and is expected to be complete by the end of the first quarter of 2010.
This phase 2b trial is anti cipated to enroll approximately 400 treatment-naive, genotype-1 or genotype-4 HCV-infected patients. The five arm trial, initiated in April 2009, is evaluating the dose and duration of RG7128 in combination with peginterferon plus ribavirin. The primary efficacy endpoint of the trial is the proportion of patients that achieve a sustained virologic response (SVR).
In the first quarter 2010, Roche plans to initiate longer duration, phase 2b studies with RG7128 in combination with peginterferon and ribavirin. An additional study in patients infected with HCV genotypes 2 and 3 is being planned to initiate later in 2010.
INFORM-1 Trial
In November 2008, Roche initiated the INFORM-1 trial, a ground-breaking study to investigate the activity of a combination of two oral antiviral molecules in the absence of interferon and ribavirin. The study investigated the combination of Pharmasset's RG7128 with InterMune's RG7227, an HCV protease inhibitor.
In Ap ril 2009, Pharmasset, Roche and InterMune reported interim results from this study at the European Association for the Study of the Liver (EASL) in Copenhagen, Denmark. These interim results demonstrated for the first time that the combination of an oral protease inhibitor and an oral nucleoside polymerase inhibitor resulted in significant HCV viral load reduction in patients with HCV over 13 days of dosing of the combination of RG7227 and RG7128 (without peginterferon or ribavirin). No treatment-related serious adverse events, no dose reductions and no discontinuations were reported during the study. Pharmacokinetic analysis confirmed that there were no drug-drug interactions between the compounds.
Roche expects to initiate a Phase 2 program of multiple INFORM studies during the first calendar quarter of 2010. Roche expects these INFORM-2 studies to investigate rapid virologic response (RVR) achieved by twice-daily dosing of RG7128 and RG7227 alone, in combination wit h peginterferon, in combination with ribavirin, or in combination wi th both peginterferon and ribavirin. Roche expects to initiate longer term studies evaluating SVR during the first half of 2010.
PSI-7851
PSI-7851 is a pro-drug of a pyrimidine nucleotide analog polymerase inhibitor and is currently in development for the treatment of chronic HCV infection. During March 2009, we initiated a Phase 1 study for PSI-7851. A single ascending dose study was conducted that assessed the safety, tolerability and pharmacokinetics of PSI-7851 in healthy subjects at doses ranging from 25mg to 800mg. PSI-7851 was found to be generally safe and well tolerated and, therefore, was advanced into a multiple ascending dose trial.
In June 2009, we initiated a phase 1 multiple ascending dose (MAD) study in HCV-infected patients. Subjects were enrolled at two U.S. centers and randomized to PSI-7851 (8 per cohort) or placebo (2 per cohort) . Final results from the MAD study were presented in a late breaker poster at AASLD on November 2, 2009. In the MAD study, PSI-7851 was generally safe and well tolerated across all cohorts with no discontinuations, no serious adverse events, and no dose-related trends in adverse events or laboratory abnormalities. Further, PSI-7851 demonstrated dose-dependent potent antiviral activity with a maximum mean HCV RNA decrease of 1.95 log10 IU/mL in patients receiving 50mg QD, 100mg QD, 200mg QD and 400mg QD administered for 3 days.
PSI-938 and PSI-879
During 2009, we nominated two development candidates from our purine nucleotide analog polymerase inhibitor program for the treatment of chronic HCV. In June 2009, we nominated PSI-938 for further pre-clinical development required for an application with the FDA or equivalent foreign regulatory agency to begin clinical studies. Our plan is to submit an IND, or its foreign equivalent, during the first calendar qu arter of 2010.
In September 2009, we nominated a second purine nucleotide analog, PSI-879, for pre-clinical development. PSI-879 differs from PSI-938 in the prodrug technology that it employs. We anticipate filing an IND, or its foreign equivalent, for PSI-879 in the fourth quarter of 2010.
Termination of Clevudine Registration Trials
On April 20, 2009, following consultations with our independent Data Safety Monitoring Board and the FDA, we voluntarily terminated our phase 3 studies of clevudine after we became aware of a number of spontaneous Serious Adverse Event reports and Events of Special Interest in patients receiving clevudine as prescribed therapy for HBV in South Korea, where the drug is marketed by Bukwang under the trade name Levovir, and in Hong Kong, where clinical studies were being conducted under the sponsorship of Bukwang. Given the number and severity of cases observed in South Korea and Hong Kong, we determined it was in the best interest of patients to voluntarily terminate our registration stu dies. All patients have now completed the follow-up period and we anticipate concluding activities by the end of the quarter ending December 31, 2009.
"Pharmasset has had a tremendous year on all fronts," said Schaefer Price, Pharmasset's President and CEO. "In collaboration with Roche, we are advancing our first in class nucleoside analog, RG7128, through a phase 2b trial and also exploring the paradigm-changing model of an all oral (interferon sparing) regimen for HCV. We reported best in class results with our second generation nucleotide analog inhibitor, PSI-7851 and anticipate starting phase 2a trials in the first quarter 2010. We believe nucleosides/tides will have an advantage in the marketplace when used with the current standard of care, due to their high RVR rates, pan-genotype activity and high barrier to resistance. In the future, as we move towards oral combinations, we believe our nucleoside/tides have the potential to be used in combination with one ano ther and with other classes of direct acting antivirals."
Financial Results
For the fiscal year ended September 30, 2009 Pharmasset reported revenues of $13.3 million, compared with revenues of $1.9 million for the fiscal year 2008. The receipt of a $10.0 million milestone from Roche for the initiation of the phase 2b study with RG7128 led to higher reported revenues in the fiscal year 2009.
Total costs and expenses for the fiscal year ended September 30, 2009 were $65.9 million, of which $26.7 million was associated with clevudine. This compares to $56.3 million for the same period in 2008, of which $26.5 million was related to clevudine. The increased operating expenses for fiscal year 2009 were primarily the result of an increase in preclinical and clinical trial expenses for PSI-7851 for the treatment of chronic HCV infection.
Pharmasset reported a net loss attributable to common stockholders of $55.6 million, or $2.10 per share, as compared to a net loss attributable to common stockholders of $54.7 millio n, or $2.51 per share for the same period in 2008.
Calendar Year 2010 Anticipated Milestones
-- Roche anticipates completion of enrollment for Cohort 2 in the RG7128 phase 2b trial by the end of first quarter of 2010
-- We expect to initiate phase 2a trial with PSI-7851 in the first quarter of 2010 with interim data in the third quarter 2010
-- Roche expects to initiate INFORM-2 in first quarter 2010
-- We expect to file an IND for PSI-938 in first quarter of 2010
-- Roche expects to initiate longer duration, phase 2b studies with RG7128 in combination with pegylated interferon and ribavirin in first half of 2010
-- Roche expects to initiate longer duration INFORM studies to investigate SVR in the first half of 2010
-- We expect to initiate phase 1 trial with PSI-938 in first quarter of 2010 with interim data in the third quarter 2010
-- Roche expects to initiate a phase 2 study in genotype 2 and 3 HCV patients w ith RG7128 in the second half of 2010
-- We expect to file an IND for PSI-879 in fourth quarter of 2010
About Pharmasset
Pharmasset is a clinical-stage pharmaceutical company committed to discovering, developing, and commercializing novel drugs to treat viral infections. Pharmasset's primary focus is on the development of oral therapeutics for the treatment of hepatitis C virus (HCV) and, secondarily, on the development of Racivir(TM) for the treatment of human immunodeficiency virus (HIV). Our research and development efforts focus on nucleoside/tide analogs, a class of compounds which act as alternative substrates for the viral polymerase thus inhibiting viral replication. We currently have three clinical-stage product candidates. RG7128, a nucleoside analog for chronic HCV infections, is in a Phase 2b clinical trial in combination with Pegasys(R) plus Copegus(R) and is also in INFORM studies, the first series of studies designed to assess the potential of combinations of small molecules without Pegasys(R) and Cop egus(R) to treat chronic HCV. These clinical studies are being conducted through a strategic collaboration with Roche. Our other clinical stage candidates include PSI-7851, an unpartnered, next generation HCV nucleotide analog, which has completed initial Phase 1 clinical studies that provided supportive safety and efficacy data to initiate a Phase 2a trial in 1Q 2010 and Racivir, for the treatment of HIV, which has completed a Phase 2 clinical trial. We have also recently announced the nomination of two purine nucleotide analogs, PSI-938 and PSI-879, for preclinical development.
Pegasys(R) and Copegus(R) are registered trademarks of Roche.
Contact
Richard E. T. Smith, Ph.D.
VP, Investor Relations and Corporate Communications
richard.smith@pharmasset.com
Office: +1 (609) 613-4181
Forward-Looking Statements
Pharmasset "Safe Harbor" Statement under the Private Securities Litigation Reform Act of 1995: Statements in this press release regarding our business that are not historical facts are "forward-looking statements" that involve risks and uncertainties, including, without limitation, the risk that adverse events could cause the cessation or delay of any of the ongoing or planned clinical trials and/or our development of our product candidates, the risk that the results of previously conducted studies involving our product candidates will not be repeated or observed in ongoing or future studies involving our product candidates, the risk that our collaboration with Roche will not continue or will not be successful and the risk that any one or more of our product candidates will not be successfully developed and commercialized. For a discussion of these risks and uncertainties, any of which could cause our actual results to di ffer from those contained in the forward-looking statements, see the section of our Annual Report on Form 10-K for the fiscal year ended September 30, 2009 filed with the Securities and Exchange Commission entitled "Risk Factors" and discussions of potential risks and uncertainties in our subsequent filings with the Securities and Exchange Commission.
Characterization of resistance to the protease inhibitor boceprevir in hepatitis C virus-infected patients
Characterization of resistance to the protease inhibitor boceprevir in hepatitis C virus-infected patients
Hepatology Dec 2009
from Jules: we do not yet understand HCV drug resistance well enough to predict exactly how it will affect patient outcomes regarding the degree of cross-resistance between HCV protease inhibitors after failing one HCV protease and whether a second course of therapy with a HCV protease can be effective. There are several lines of thinking including on a more positive approach that if a patient develops drug resistance to a HCV protease that if you wait a while and retreat with a regimen that includes a HCV protease plus a HCV NRTI or NNRTI plus of course peg/rbv that the NRTI/NNRTI will suppress HCV protease resistant virus and the HCV protease will suppress wild-type virus, and that after waiting a while after failing initial therapy with resistance observed that resistance will fade and perhaps be less of a concern. This is a hopeful interpretation or possible outcome. At the recent AASLD Tibotec reported in a poster they retreated patients who failed TMC435 monotherapy with TMC435+peg/rbv and these patients responded well, they were undetectable after 28 days. Although encouraging, the study did not appear to look at patients with detectable mutations when they they were retreated with triple therapy. A negative outcome would be that if you fail a HCV protease and resistance is observed that resistance could prevent response to another treatment regimen with a protease. Boosting HCV proteases with ritonavir is being researched and like in HIV high levels of the protease might prevent or suppress resistance. Also, there are other classes of drugs in development so a regimen comprised of other classes could be effective without a protease. There are several different types of HCV NNRTIs that appear to have different binding sites and different resistance profiles that could be combined. Second generation or 'salvage' protease inhibitors or protease inhibitors with high drug levels might be effective in suppressing HCV protease resistance.
"Further detailed analyses are required to determine the potential long-term persistence of the observed variants and to characterize resistant mutations selected during treatment with higher doses of boceprevir in combination with peginterferon and ribavirin."......"As previously observed for telaprevir, the frequency of resistant variants at the end of treatment generally decreased during follow-up in patients treated with boceprevir.[19]"......"The results of this study are consistent with previous in vitro studies[15][17][18][28] showing that the cross-resistance profiles of the two linear peptidomimetic ketoamides boceprevir and telaprevir are largely overlapping......the probability of selection of resistant variants followed by a viral breakthrough is significantly reduced by combination therapy of NS3 protease inhibitors with peginterferon and ribavirin[7][13][14][27] and potentially by the addition of a lead-in phase with peginterferon and ribavirin alone. To answer these questions, results of resistance analysis from the phase 2b studies (SPRINT-1, PROVE1/2) have to be awaited."
Simone Susser 1, Christoph Welsch 1 2, Yalan Wang 4, Markus Zettler 1, Francisco S. Domingues 2, Ursula Karey 1, Eric Hughes 3, Robert Ralston 3, Xiao Tong 3, Eva Herrmann 4, Stefan Zeuzem 1, Christoph Sarrazin 1 *
1J. W. Goethe University Hospital, Frankfurt, Germany
2Max Planck Institute for Informatics, Saarbrücken, Germany
3Schering-Plough Research Institute, Kenilworth, NJ
4J. W. Goethe University, Institute of Biostatistics and Mathematical Modeling, Frankfurt, Germany
email: Christoph Sarrazin (sarrazin@em.uni-frankfurt.de)
*Correspondence to Christoph Sarrazin, J. W. Goethe University Hospital, 60590 Frankfurt am Main, Germany
Abstract
Boceprevir is a hepatitis C virus (HCV) nonstructural protein (NS) 3/4A protease inhibitor that is currently being evaluated in combination with peginterferon alfa-2b and ribavirin in phase 3 studies. The clinical resistance profile of boceprevir is not characterized in detail so far. The NS3 protease domain of viral RNA was cloned from HCV genotype 1-infected patients (n = 22). A mean number of 47 clones were sequenced before, at the end, and after treatment with 400 mg boceprevir twice or three times daily for 14 days for genotypic, phenotypic, and viral fitness analysis. At the end of treatment, a wild-type an NS3 protease sequence was observed with a mean frequency of 85.9%. In the remaining isolates, five previously observed resistance mutations (V36M/A, T54A/S, R155K/T, A156S, V170A) and one mutation (V55A) with unknown resistance to boceprevir were detected either alone or in combination. Phenotypic analysis in the HCV replicon assay showed low (V36G, T54S, R155L; 3.8- to 5.5-fold 50% inhibitory concentration [IC50]), medium (V55A, R155K, V170A, T54A, A156S; 6.8- to 17.7-fold IC50) and high level (A156T; >120-fold IC50) resistance to boceprevir. The overall frequency of resistant mutations and the level of resistance increased with greater declines in mean maximum HCV RNA levels. Two weeks after the end of treatment, the frequency of resistant variants declined and the number of wild-type isolates increased to 95.5%. With the exception of V36 and V170 variants all resistant mutations declined by more than 50%. Mathematical modeling revealed impaired replicative fitness for all single mutations, whereas for combined mutations a relative increase of replication efficiency was suggested.
Conclusion: During boceprevir monotherapy, resistance mutations at six positions within the NS3 protease were detected by way of clonal sequence analysis. All mutations are associated with reduced replicative fitness estimated by mathematical modeling and show cross-resistance to telaprevir.
According to an estimate by the World Health Organization, approximately 180 million people worldwide are affected by the hepatitis C virus (HCV). Of these, at least 130 million are chronic HCV carriers with a significant risk of developing liver cirrhosis and liver cancer. Chronic hepatitis C is a leading cause of liver transplantation in developed countries.[1]
HCV is an enveloped, 9.6 kb, positive-sense, single-stranded RNA virus from the genus Hepacivirus and the family Flaviviridae. Viral and host peptidases cleave the large open reading frame, resulting in three structural proteins (core, envelope 1, and envelope 2), a small protein named p7, and six nonstructural (NS) proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B). There is a noncoding region of 324-341 nucleotides at the 5 end containing the internal ribosome entry site and a 3 noncoding region of variable length that also plays an important role in the replication process.[2] Because of the high replication rate of the virus (1012 virions per day) and the high mutation frequency during replication of the viral RNA, it has been calculated that every possible variant of the virus is produced every day in an infected individual, leading to the circulation of multiple genetically distinct but closely related virus subpopulations (quasispecies). In addition, recombination of HCV was reported to contribute to the genetic diversity to a small extent as well.[3]
The current standard of treatment for patients with chronic hepatitis C consists of the administration of peginterferon alfa and ribavirin for 24 or 48 weeks.[4] Significant side effects are characteristic for this treatment, and for patients infected with the most prevalent genotype 1, a sustained virologic response only can be achieved in about 50% of the patients.[5]
Thus, better tolerated and more effective treatment options are urgently needed. A promising approach is the development of specifically targeted antiviral therapies for hepatitis C (STAT-C). HCV-specific protease inhibitors target an essential step in HCV replication by blocking the NS3/4A protease-dependent cleavage of the HCV polyprotein. Several peptidomimetic NS3 protease inhibitors have been developed and are currently investigated in clinical trials. Two linear peptidomimetic ketoamides (boceprevir and telaprevir) have entered phase 3 studies[6-8] and several macrocyclic inhibitors (i.e. ITMN-191, BI201335, TMC-435350, and MK7009) are in phase 1/2 development.[9-12] Results from phase 2 studies with boceprevir and telaprevir in naïve patients with genotype 1 infection showed a significant improvement in comparison with the standard of care with sustained virologic response rates up to 75% for triple therapy with boceprevir, peginterferon alfa-2b and ribavirin for 48 weeks. In addition, some studies have suggested that it may be possible to shorten treatment duration for patients who achieve a rapid virologic response.[13][14]
Knowledge of the resistance profile of individual targeted antiviral drugs is critical for predicting which drug combinations are appropriate for use in treatment. Preexisting resistant variants within the HCV virus population in an individual patient can be selected during treatment with a targeted antiviral, leading to treatment failure and development of cross-resistance to related compounds. The HCV replicon has been used as an in vitro system to identify individual resistance mutations for several NS3/4A protease inhibitors.[15-18] However, clonal sequence analysis of the NS3 protease in subjects participating in a telaprevir monotherapy study revealed several previously unknown mutations associated with resistance.[19] In addition to the high sensitivity of clonal analysis for low-level resistant variants, this finding is explained by the fact that some mutations were observed only in subtype 1a isolates, whereas the replicon studies are based on an HCV subtype 1b consensus strain.
For boceprevir, three resistant variants were identified in the replicon system (T54A, A156S, and V170A).[17] In a monotherapy study, mutations at position V170 were detected by population sequencing in a single patient who received boceprevir alone for 2 weeks; however, this method cannot reliably detect mutations at frequencies below 20% to 25%.[20]
In the present study, genotypic resistance analysis using population sequence in baseline samples and clonal sequencing in samples at end-of-treatment and follow-up, which can detect minor variants with a frequency of as low as 5% to 7%, was performed in genotype 1-infected patients treated in a phase 1 study with boceprevir alone for 2 weeks. Phenotypic resistance levels based on replicon IC50 were calculated by curve-fitting of the dose-response curves. In addition, we estimated relative viral fitness based on a multiple variant viral kinetic model to define the relationship between resistance and fitness for variants in the virus population undergoing selection in vivo.
Discussion
With the development of direct antiviral drugs, treatment options for HCV-infected individuals will be broadened considerably. Currently, two of the NS3 protease inhibitors are in phase 3 clinical development, boceprevir and telaprevir. Based on the results of the completed phase 2b studies showing a significant increase in sustained virologic response rates,[13][14][26] the new standard treatment will likely include the use of a protease inhibitor in combination therapy with peginterferon and ribavirin. However, as with other direct antiviral therapies for other viruses such as human immunodeficiency virus, resistant HCV variants may be selected during treatment with STAT-C compounds.[19][27]
In the present study, the resistance profile of boceprevir generated during a 14-day monotherapy phase 1b study was assessed using population sequencing for baseline samples and a clonal sequencing approach at the end of treatment and follow-up.
A selection of a high number of variants (n = 25) with a high variability was already reported for telaprevir monotherapy and seems to be typical for HCV.[19] An increase of the frequency of a resistant variant without the presence of the antiviral drug seems to be very unlikely, because such a variant should have an equal or even higher replicative fitness than the wild-type variant. For the present study, a restriction to variants with a >5% increase, present in more than one patient and with a decline after end of treatment was imposed. Future investigations are required to detect a potential importance of variants detected at lower frequencies.
We found mutations at six positions within the NS3 protease to be associated with different levels of resistance to boceprevir. Initially, when using a population-based sequence analysis, only one mutation at position V170 was detected in a single patient in the study. This highlights the ability of clonal sequencing to provide more information about the resistance profile of STAT-C drugs than population sequencing. In addition to boceprevir-resistant mutations previously identified in the replicon system (T54A, A156S, V170A), mutations at several other positions were identified within the NS3 protease based on an increased frequency at the end of treatment followed by a decline thereafter. Phenotypic characterization of all potential resistance mutations identified by clonal sequencing and frequency analysis identified six loci that were clearly associated with resistance to boceprevir (V36, T54, V55, R155, A156, V170). Presence of these variants already at baseline at high frequencies (20% to 25%) was excluded by population-based sequencing in the present study and is highly unlikely at frequencies around 5% based on the results of a previous study with clonal sequencing at baseline.[19]
The results of this study are consistent with previous in vitro studies[15][17][18][28] showing that the cross-resistance profiles of the two linear peptidomimetic ketoamides boceprevir and telaprevir are largely overlapping. Furthermore, previously described differences of variants selected by genotype 1a or 1b HCV subtypes only, were confirmed. However, differences between the frequencies of specific resistance mutations have been observed in the clinical monotherapy studies of boceprevir and telaprevir. These differences in mutation frequency may be related to the different drugs as well as differences in the patient populations and the doses used in the studies. In treatment-naïve and previously treated patients who received telaprevir at doses of 450 mg every 8 hours, 750 mg every 8 hours, or 1,250 mg every 12 hours, approximately 90% of clones sequenced from end of treatment samples contained resistant variants.[19] In the present study of interferon nonresponder patients who received boceprevir monotherapy at doses of 400 mg BID or TID, a mean frequency of 85.9% of clones contained wild-type NS3 protease sequence at the end-of-treatment. Overall, the frequency of resistant variants was associated with viral load decline. In patients with a maximum decline of HCV-RNA concentrations of at least 2 log10 steps, resistant variants were observed more frequently than in those with a less pronounced decline. The A156S variant, which has a medium level of resistance but low fitness, was observed only in patients with a 2 log10 decline in HCV-RNA concentrations. Interestingly, the A156T variant, which confers the highest level of resistance but exhibits the lowest fitness, was not detected in the patients treated with boceprevir 400 mg TID or BID. The mean viral decline of boceprevir in the present study was lower than that in the phase 1b monotherapy study for different doses of telaprevir.[8][20] In subsequent phase 2 studies as well as the currently ongoing phase 3 study, boceprevir is dosed with 800 mg TID in combination with peginterferon and ribavirin. Moreover, the probability of selection of resistant variants followed by a viral breakthrough is significantly reduced by combination therapy of NS3 protease inhibitors with peginterferon and ribavirin[7][13][14][27] and potentially by the addition of a lead-in phase with peginterferon and ribavirin alone. To answer these questions, results of resistance analysis from the phase 2b studies (SPRINT-1, PROVE1/2) have to be awaited.
In addition, several amino acid mutations frequently detected in the patients treated with boceprevir showed some differences in resistance to telaprevir. T54A was detected more frequently in boceprevir treated patients despite a similar resistance profile (less than two-fold difference) in the replicon assay. V170A mutations conferred a higher level of resistance to boceprevir in comparison with telaprevir in the phenotypic assay, and this variant was frequently detected in boceprevir-treated patients but was not described to be a frequent variant in patients who received telaprevir monotherapy.[19] In contrast, mutation A156S conferred a higher level of resistance to telaprevir than boceprevir.[18] As previously observed for telaprevir, the frequency of resistant variants at the end of treatment generally decreased during follow-up in patients treated with boceprevir.[19]
In the present study, V55A was identified as a new variant to be associated with resistance in patients treated with boceprevir. Resistance to boceprevir by the V55A variant as well as telaprevir with a relative low IC50 was confirmed in the phenotypic assay. However, V55A was not described to be selected during telaprevir monotherapy or combination therapy with peginterferon in phase 1 trials.[19][27] Phenotypic characterization showed slightly higher resistance in replicon assay (6.9-fold versus 3.1-fold) as well as in enzyme assay (4.2-fold versus 2.7-fold) for V55A to boceprevir than to telaprevir. In silico analysis showed that interaction between V55A and S139 or R155 may be responsible for impaired binding of boceprevir. Studies of larger population of patients treated with boceprevir or telaprevir will be required to fully understand the clinical emergence of this novel mutation.
In the present study, only the NS3 protease gene was sequenced. Thus, it is unclear to which extent mutations within the NS4A cofactor and/or at the NS3/4A protease cleavage sites may contribute to confer resistance or to compensation of impaired NS3/4A function. Mutations outside the NS3 protease are not anticipated, and in a recent study of telaprevir in combination with peginterferon and ribavirin, no mutations at the cleavage sites have been detected.[29]
Taken together, during boceprevir monotherapy with 400 mg BID and TID resistance mutations at six positions within the NS3 protease (V36M/A, T54A/S, V55A, R155K/T, A156S, V170A) were detected by a highly sensitive, clonal sequencing method. Generally, mutations were observed at relative low frequencies within the HCV virus population and a strong correlation of the presence of resistant variants with a more pronounced decline of HCV-RNA concentrations was observed. All detected variants showed cross-resistance to telaprevir in the phenotypic assay. However, differences for frequency of detection and/or resistance levels between boceprevir and telaprevir were observed, and this was mainly true for the T54A and V170A mutations. Also, the newly described V55A variant seems to be selected in boceprevir-treated patients only. Impaired viral fitness of single resistant variants was estimated in a mathematical model while combined mutations showed a relative increase of replication efficiency. Further detailed analyses are required to determine the potential long-term persistence of the observed variants and to characterize resistant mutations selected during treatment with higher doses of boceprevir in combination with peginterferon and ribavirin.
Results
Virologic Response
The samples analyzed in this study were obtained from 22 nonresponder (to previous standard treatment) patients infected with HCV subtype 1a (n = 8) or 1b (n = 14) who were dosed for 14 days with boceprevir in a randomized, placebo-controlled double-blind, phase 1 study (Table 1). Patients who received 400 mg boceprevir BID or TID had a decline of up to 3 log10 HCV-RNA IU/mL. The patients were divided into two groups according to virologic response: (1) patients with a maximum decline 2 log10 HCV-RNA IU/mL (n = 15) and (2) patients with a maximum decline <2 log10 HCV-RNA IU/mL (n = 7). Fig. 1C shows viral kinetics for these two groups, which are also separated for the different subtypes. Samples for sequence analysis were obtained at baseline, at end of treatment (day 14), and at end of follow-up (day 28).
Table 1. Distribution of Known Resistance Mutations Occurring at End of Therapy (HCV-RNA Decline <2 log10 IU/mL; HCV RNA decline >/=2 log10 IU/mL)
Picture 12.png
Picture 13.png
Genotypic Resistance Analysis
No resistant variants were observed by population sequencing in baseline samples. Generally, a relatively high genetic heterogeneity was observed within the HCV virus population at the end of treatment. Based on a mean difference of more than 5% within the HCV virus population when compared with baseline samples, altogether mutations at 31 amino acid positions within the NS3 protease were detected: 7, 8, 14, 18, 33, 36, 46, 48, 49, 54, 55, 61, 71, 72, 80, 86, 87, 91, 117, 119, 122, 127, 131, 146, 147, 153, 155, 156, 170, 174, and 179. A restriction to mutations detectable in more than one patient still resulted in changes at 19 amino acid positions of the NS3 protease. Thus, further analysis was restricted to mutations that were observed in more than one patient and showed a decline in frequency during follow-up (n = 9).
The following mutations were observed at amino acid positions that have been shown to be associated with resistance to other protease inhibitors: V36M/A (three patients), T54S/A (10 patients), R155K/T/P (six patients), A156S (three patients), and V170A/L (five patients); these changes occur either as single mutations or as double mutations (V36M + T54S, V36A + R155K, T54S/A + R155K, and T54S + A156S each in one patient). Amino acid mutations V36M and R155K/T were detected only in subtype 1a isolates, presumably because two nucleotide substitutions are required to create these amino acid changes in subtype 1b isolates. Interestingly, no mutations were observed at position R155 in subtype 1b isolates with the exception of a single clone with R155P in one patient.
In addition, we detected four amino acid sites with novel mutations (V48I, V55A, T72I, and I153V) with so far unknown clinical significance for resistance to a protease inhibitor. Selection of V170A and T72I was restricted to subtype 1b patients. Subtype 1a patients all carried I170 and I72 as wild-type amino acids.
Irrespective of variants which are detectable in a specific HCV subtype only (see above) generally, the frequency of resistant variants detected in subtype 1a and subtype 1b patients was similar.
Distribution of Mutations according to Virologic Response
Patients with a Maximum Decline >/=2 log10 HCV-RNA IU/mL.
The mean frequency of mutations versus baseline samples at positions V36 (1.4%), T54 (5.0%), R155 (6.9%), A156 (0.8%), and V170 (3.9%) was 18% at the end of treatment in patients with a maximum HCV-RNA decline of 2 log10. The frequency of mutations at these positions declined to 6% by the end-of-follow-up (P = 0.05). No mutations at position A156 were detected at the end of follow-up. The mean frequency of the potentially new resistance mutations at positions V48, V55, T72, and I153 was 15% at the end of treatment and declined to 10% at the end of follow-up (P > 0.2) (Fig. 1A).
Patients with a Maximum Decline <2 log10 HCV-RNA IU/mL.
In this group of patients, the mean frequency of known (7% at end of treatment) as well as potentially new resistance mutations (4% at end of treatment) decline to 1% by day 28 (P > 0.2 and P = 0.06, respectively) (Fig. 1B).
Overall, irrespective of viral kinetics in 7 of 22 and 9 of 22 patients, only wild-type variants without any resistance mutations at positions V36, T54, V55, R155, A156, and V170 were detected at end of treatment and end of follow-up, respectively. For two patients, long-term follow-up serum samples were available, and no resistant variants have been detected by clonal sequencing in either of these patients 2.5 to 4 years after the end of treatment.
Phenotypic Resistance Analysis
Replicon IC50 values from the known and the potentially new mutations are shown in Fig. 2A. As expected, a change at position 156 (A156T) conferred high-level resistance (>120-fold increase in IC50) against boceprevir, whereas changes at positions 36, 54, 155, 156, and 170 conferred low to moderate resistance (3.8- to 17.7-fold change in IC50). Three of the four newly detected variants (V48I, T72I, and I153V) did not differ from wild-type IC50. However, the substitution from valine to alanine at position 55 showed a clear increase in resistance in the replicon model (6.9-fold). Resistance of the V55A mutation to boceprevir was also confirmed using the in vitro enzymatic assay for NS3 protease (Table 2).
Cross-resistance to Telaprevir
For mutations at several amino acid positions (V36, T54, R155, A156), previously reported resistance at different levels against telaprevir[19][21] was confirmed in the present study. In addition, cross-resistance to telaprevir was shown for mutations at position V170 and for the newly characterized mutation V55A (Fig. 2B). A direct comparison of the IC50 values of both compounds is shown in Fig. 3. Rank correlation between the IC50 values was 0.82 (P = 0.002).
Mathematical Modeling of Relative in Vivo Fitness of Resistant Variants
Replicative fitness of individual NS3 resistant variants was estimated based on mutational frequencies, phenotypic resistance levels and viral kinetics. The fitting procedure using all patient data converged. In addition to relative fitness levels, estimates also were obtained for infected cell loss rate with a median of 0.11 per day (quartiles: 0.03 and 0.24 per day) and a median treatment efficiency in wild-type of 96.7% (quartiles: 94.4% and 98.6%). The viral kinetic modeling method provides an estimate of the fitness of each NS3-resistant variant based on that variant's replacement frequency relative to other NS3 variants (including wild-type) identified within the population.
Overall, an inverse correlation between the resistance potential and the fitness of variants with single mutations can be observed (rank correlation: -0.762, P = 0.037). Amino acid changes at position 156 conferred the highest level of resistance but had the lowest relative fitness (Fig. 4). As described, relative fitness increased if the variant carried a second resistance mutation (i.e., V36A + R155K).[19] No differences were observed for subtypes 1a and 1b. Globally fitted values of estimated relative fitness for all reported mutations are shown in Table 3.
In silico Analysis
Results from in silico analysis are described in the Supporting Information.
Patients and Methods
Patient Population and Study Design.
Forty-six patients were enrolled into a randomized, double-blind, placebo-controlled, 14-day multiple dose, phase 1b trial and received one of the following doses of boceprevir: 100 mg every 12 hours (12 patients), 200 mg every 12 hours (11 patients), 400 mg every 12 hours (11 patients), 400 mg every 8 hours (12 patients), or placebo. For the present study, patients who received the highest dose (400 mg) every 12 hours (BID) or every 8 hours (TID) were selected because with the lower doses only weak virologic responses have been observed (approximately 0.5 log decline). All patients had a chronic hepatitis C with plasma HCV-RNA levels of 7 � 104 IU/mL or greater and negative hepatitis B antigen and antibodies to human immunodeficiency virus 1 and 2. Written informed consent was obtained from each patient in accordance with the 1975 Declaration of Helsinki. For HCV-RNA determination and genotypic analysis presented in this report, serum samples were collected and subsequently stored at -80�C from all patients before dosing (baseline), at the end of dosing (day 14), and 14 days after the end of treatment (follow-up). HCV-RNA was measured by extracting total RNA from the sample and using an in-house real-time reverse-transcription polymerase chain reaction (PCR) assay.
Amplification and Sequencing of the Gene Encoding the HCV NS3 Protease.
Amplification of the complete region encoding the NS3 protease catalytic domain was performed as described by Sarrazin et al.[19] In genotype 1a samples, a 620-bp fragment was amplified by using the following primers: NS3-1a-1s, CCGGGAGATACTGCTCGGAC; NS3-1a-2s, CCGATGGAATGGTCTCCAAGG; NS3-1a-1a, GCTCTGGGGCACTGCTG; and NS3-1a-2a, GAGAGGAGTTGTCCGTGAACAC. A mean number of 47 clones were amplified and sequenced per patient for end of treatment and end of follow-up at J. W. Goethe University Hospital (lower limit of variant detection of 7% with a 95% confidence interval). Population sequencing was performed on baseline samples. The molecular clones and the amplified baseline samples were subjected to sequence PCR according to the manufacturer's instructions using the M13 forward or M13 reverse primers (BigDye Deoxy Terminators; Applied Biosystems, Foster City, CA). Sequencing was performed by an automat (3100 DNA Sequencer; Applied Biosystems, Foster City, CA).
Sequence Alignment and Analysis.
Sequences for the N-terminal 543 nucleotides (181 amino acids) of the NS3 protease were aligned and analyzed for mutations using the software Mutational Surveyor (SoftGenetics, State College, PA). Mean frequencies of mutations at end-of-treatment and end-of-follow-up were calculated for each patient compared with the respective baseline consensus sequence. For a summary of all patients with similar viral kinetics (< versus 2 log10 maximum decline), mean mutations frequencies were calculated based on the results from single patients. GenBank accession numbers: the GenBank accession numbers for the baseline consensus sequences of the NS3 protease of the 22 patients of the present study are GQ500976-GQ500997.
Determination of the Mutant Replicon IC50 and IC90.
Generation of HCV replicon cells and IC50 determination of antiviral agents in the HCV replicon assay was described by Welsch et al.[21] Point mutations were generated with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions.
All mutational replicon assays were based on the Con-1 backbone (HCV subtype 1b) even for variants which were detected mainly or exclusively in subtype 1a patients and were performed at J. W. Goethe University Hospital. HCV replicon cells were seeded in a 24-well plate at a density of 2 � 104 cells per well in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. The level of HCV-RNA in replicon cells was determined by a real-time quantitative reverse-transcription PCR assay (Taqman) on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). The IC50/IC90 was defined as the concentration of compound at which the HCV-RNA level in the replicon cells was reduced by 50%/90%. The IC50 and IC90 values of boceprevir and telaprevir were calculated by curve-fitting of the dose-response curves. The boceprevir replicon IC50 phenotype mean values are based on at least two independent experiments.
Determination of the Mutant Enzyme IC50 of the V55A Variant.
All enzyme assays were performed at Schering Plough Research Institute. Introduction of the point mutation was described above. The parental plasmid expressing His-tagged single chain NS4A-NS3 protease domain, NS4A21-32-GSGS-NS33-181, as well as the expression and purification protocol was described by Taremi et al.[22] Recombinant proteases were tested using a chromogenic assay as described by Zhang et al.[23] The overall inhibition constant Ki* (where vs = VmaxS / (Km(1 + 1/Ki*))) was used to measure inhibitor potency.
Fitness Analysis.
The multiple kinetic model is described by a differential equation system, which models the behavior of both wild-type and resistant viral variants similar to a multiple variant viral dynamic model to estimate fitness of HCV genotype 1-resistant variants in subjects dosed with telaprevir.[24][25] The differential equation system has three types of compartments, namely target cells (T), infected cells (Ií), and virus in plasma (Vi) where i {1,K, K}. The dependencies between the different compartments are modeled by a differential equation system:
Here, is the infection rate, the degradation rate of infected cells which was bounded from below by 0.01, p the production rate of wild-type virus, c the viral clearance rate, mji the mutation rate from the jth variant to ith variant during one life-cycle step, and, finally, j and fj are the efficacies of the drug for the variants and the relative fitnesses of the variant, respectively. The model uses specific fitness parameters for each variant and treatment efficacies are derived from the individual wild-type efficacy and in vitro replicon IC50 and IC90 values of the variants. Further viral kinetic parameters such as viral clearance, infected-cell loss, and de novo infection rates are assumed to be identical for all variants but can be patient-specific. The model also accounts for a shared and limited HCV replication space by assuming that the total number of infected and uninfected target cells is constant (L). The model was fitted to all HCV patient data (daily HCV-RNA concentrations from day 1 to 14 and at day 28) simultaneously using a maximum likelihood approach iterating between fitting individual parameters on one hand and global variant fitnesses on the other hand. This iteration and the objective function were implemented in MATLAB (MathWorks, Inc., Natick, MA).
In Silico Analysis.
Methods used for in silico analysis are described in the Supporting Information.
Statistical Analysis.
Continuous variables were compared with Wilcoxon paired sample test and Spearman rank correlation coefficients were calculated. All tests were two-tailed for a significance level of 0.05. Statistical analyses were done using SPSS for Windows, release 16 (SPSS Inc, Chicago, IL).
Hepatology Dec 2009
from Jules: we do not yet understand HCV drug resistance well enough to predict exactly how it will affect patient outcomes regarding the degree of cross-resistance between HCV protease inhibitors after failing one HCV protease and whether a second course of therapy with a HCV protease can be effective. There are several lines of thinking including on a more positive approach that if a patient develops drug resistance to a HCV protease that if you wait a while and retreat with a regimen that includes a HCV protease plus a HCV NRTI or NNRTI plus of course peg/rbv that the NRTI/NNRTI will suppress HCV protease resistant virus and the HCV protease will suppress wild-type virus, and that after waiting a while after failing initial therapy with resistance observed that resistance will fade and perhaps be less of a concern. This is a hopeful interpretation or possible outcome. At the recent AASLD Tibotec reported in a poster they retreated patients who failed TMC435 monotherapy with TMC435+peg/rbv and these patients responded well, they were undetectable after 28 days. Although encouraging, the study did not appear to look at patients with detectable mutations when they they were retreated with triple therapy. A negative outcome would be that if you fail a HCV protease and resistance is observed that resistance could prevent response to another treatment regimen with a protease. Boosting HCV proteases with ritonavir is being researched and like in HIV high levels of the protease might prevent or suppress resistance. Also, there are other classes of drugs in development so a regimen comprised of other classes could be effective without a protease. There are several different types of HCV NNRTIs that appear to have different binding sites and different resistance profiles that could be combined. Second generation or 'salvage' protease inhibitors or protease inhibitors with high drug levels might be effective in suppressing HCV protease resistance.
"Further detailed analyses are required to determine the potential long-term persistence of the observed variants and to characterize resistant mutations selected during treatment with higher doses of boceprevir in combination with peginterferon and ribavirin."......"As previously observed for telaprevir, the frequency of resistant variants at the end of treatment generally decreased during follow-up in patients treated with boceprevir.[19]"......"The results of this study are consistent with previous in vitro studies[15][17][18][28] showing that the cross-resistance profiles of the two linear peptidomimetic ketoamides boceprevir and telaprevir are largely overlapping......the probability of selection of resistant variants followed by a viral breakthrough is significantly reduced by combination therapy of NS3 protease inhibitors with peginterferon and ribavirin[7][13][14][27] and potentially by the addition of a lead-in phase with peginterferon and ribavirin alone. To answer these questions, results of resistance analysis from the phase 2b studies (SPRINT-1, PROVE1/2) have to be awaited."
Simone Susser 1, Christoph Welsch 1 2, Yalan Wang 4, Markus Zettler 1, Francisco S. Domingues 2, Ursula Karey 1, Eric Hughes 3, Robert Ralston 3, Xiao Tong 3, Eva Herrmann 4, Stefan Zeuzem 1, Christoph Sarrazin 1 *
1J. W. Goethe University Hospital, Frankfurt, Germany
2Max Planck Institute for Informatics, Saarbrücken, Germany
3Schering-Plough Research Institute, Kenilworth, NJ
4J. W. Goethe University, Institute of Biostatistics and Mathematical Modeling, Frankfurt, Germany
email: Christoph Sarrazin (sarrazin@em.uni-frankfurt.de)
*Correspondence to Christoph Sarrazin, J. W. Goethe University Hospital, 60590 Frankfurt am Main, Germany
Abstract
Boceprevir is a hepatitis C virus (HCV) nonstructural protein (NS) 3/4A protease inhibitor that is currently being evaluated in combination with peginterferon alfa-2b and ribavirin in phase 3 studies. The clinical resistance profile of boceprevir is not characterized in detail so far. The NS3 protease domain of viral RNA was cloned from HCV genotype 1-infected patients (n = 22). A mean number of 47 clones were sequenced before, at the end, and after treatment with 400 mg boceprevir twice or three times daily for 14 days for genotypic, phenotypic, and viral fitness analysis. At the end of treatment, a wild-type an NS3 protease sequence was observed with a mean frequency of 85.9%. In the remaining isolates, five previously observed resistance mutations (V36M/A, T54A/S, R155K/T, A156S, V170A) and one mutation (V55A) with unknown resistance to boceprevir were detected either alone or in combination. Phenotypic analysis in the HCV replicon assay showed low (V36G, T54S, R155L; 3.8- to 5.5-fold 50% inhibitory concentration [IC50]), medium (V55A, R155K, V170A, T54A, A156S; 6.8- to 17.7-fold IC50) and high level (A156T; >120-fold IC50) resistance to boceprevir. The overall frequency of resistant mutations and the level of resistance increased with greater declines in mean maximum HCV RNA levels. Two weeks after the end of treatment, the frequency of resistant variants declined and the number of wild-type isolates increased to 95.5%. With the exception of V36 and V170 variants all resistant mutations declined by more than 50%. Mathematical modeling revealed impaired replicative fitness for all single mutations, whereas for combined mutations a relative increase of replication efficiency was suggested.
Conclusion: During boceprevir monotherapy, resistance mutations at six positions within the NS3 protease were detected by way of clonal sequence analysis. All mutations are associated with reduced replicative fitness estimated by mathematical modeling and show cross-resistance to telaprevir.
According to an estimate by the World Health Organization, approximately 180 million people worldwide are affected by the hepatitis C virus (HCV). Of these, at least 130 million are chronic HCV carriers with a significant risk of developing liver cirrhosis and liver cancer. Chronic hepatitis C is a leading cause of liver transplantation in developed countries.[1]
HCV is an enveloped, 9.6 kb, positive-sense, single-stranded RNA virus from the genus Hepacivirus and the family Flaviviridae. Viral and host peptidases cleave the large open reading frame, resulting in three structural proteins (core, envelope 1, and envelope 2), a small protein named p7, and six nonstructural (NS) proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B). There is a noncoding region of 324-341 nucleotides at the 5 end containing the internal ribosome entry site and a 3 noncoding region of variable length that also plays an important role in the replication process.[2] Because of the high replication rate of the virus (1012 virions per day) and the high mutation frequency during replication of the viral RNA, it has been calculated that every possible variant of the virus is produced every day in an infected individual, leading to the circulation of multiple genetically distinct but closely related virus subpopulations (quasispecies). In addition, recombination of HCV was reported to contribute to the genetic diversity to a small extent as well.[3]
The current standard of treatment for patients with chronic hepatitis C consists of the administration of peginterferon alfa and ribavirin for 24 or 48 weeks.[4] Significant side effects are characteristic for this treatment, and for patients infected with the most prevalent genotype 1, a sustained virologic response only can be achieved in about 50% of the patients.[5]
Thus, better tolerated and more effective treatment options are urgently needed. A promising approach is the development of specifically targeted antiviral therapies for hepatitis C (STAT-C). HCV-specific protease inhibitors target an essential step in HCV replication by blocking the NS3/4A protease-dependent cleavage of the HCV polyprotein. Several peptidomimetic NS3 protease inhibitors have been developed and are currently investigated in clinical trials. Two linear peptidomimetic ketoamides (boceprevir and telaprevir) have entered phase 3 studies[6-8] and several macrocyclic inhibitors (i.e. ITMN-191, BI201335, TMC-435350, and MK7009) are in phase 1/2 development.[9-12] Results from phase 2 studies with boceprevir and telaprevir in naïve patients with genotype 1 infection showed a significant improvement in comparison with the standard of care with sustained virologic response rates up to 75% for triple therapy with boceprevir, peginterferon alfa-2b and ribavirin for 48 weeks. In addition, some studies have suggested that it may be possible to shorten treatment duration for patients who achieve a rapid virologic response.[13][14]
Knowledge of the resistance profile of individual targeted antiviral drugs is critical for predicting which drug combinations are appropriate for use in treatment. Preexisting resistant variants within the HCV virus population in an individual patient can be selected during treatment with a targeted antiviral, leading to treatment failure and development of cross-resistance to related compounds. The HCV replicon has been used as an in vitro system to identify individual resistance mutations for several NS3/4A protease inhibitors.[15-18] However, clonal sequence analysis of the NS3 protease in subjects participating in a telaprevir monotherapy study revealed several previously unknown mutations associated with resistance.[19] In addition to the high sensitivity of clonal analysis for low-level resistant variants, this finding is explained by the fact that some mutations were observed only in subtype 1a isolates, whereas the replicon studies are based on an HCV subtype 1b consensus strain.
For boceprevir, three resistant variants were identified in the replicon system (T54A, A156S, and V170A).[17] In a monotherapy study, mutations at position V170 were detected by population sequencing in a single patient who received boceprevir alone for 2 weeks; however, this method cannot reliably detect mutations at frequencies below 20% to 25%.[20]
In the present study, genotypic resistance analysis using population sequence in baseline samples and clonal sequencing in samples at end-of-treatment and follow-up, which can detect minor variants with a frequency of as low as 5% to 7%, was performed in genotype 1-infected patients treated in a phase 1 study with boceprevir alone for 2 weeks. Phenotypic resistance levels based on replicon IC50 were calculated by curve-fitting of the dose-response curves. In addition, we estimated relative viral fitness based on a multiple variant viral kinetic model to define the relationship between resistance and fitness for variants in the virus population undergoing selection in vivo.
Discussion
With the development of direct antiviral drugs, treatment options for HCV-infected individuals will be broadened considerably. Currently, two of the NS3 protease inhibitors are in phase 3 clinical development, boceprevir and telaprevir. Based on the results of the completed phase 2b studies showing a significant increase in sustained virologic response rates,[13][14][26] the new standard treatment will likely include the use of a protease inhibitor in combination therapy with peginterferon and ribavirin. However, as with other direct antiviral therapies for other viruses such as human immunodeficiency virus, resistant HCV variants may be selected during treatment with STAT-C compounds.[19][27]
In the present study, the resistance profile of boceprevir generated during a 14-day monotherapy phase 1b study was assessed using population sequencing for baseline samples and a clonal sequencing approach at the end of treatment and follow-up.
A selection of a high number of variants (n = 25) with a high variability was already reported for telaprevir monotherapy and seems to be typical for HCV.[19] An increase of the frequency of a resistant variant without the presence of the antiviral drug seems to be very unlikely, because such a variant should have an equal or even higher replicative fitness than the wild-type variant. For the present study, a restriction to variants with a >5% increase, present in more than one patient and with a decline after end of treatment was imposed. Future investigations are required to detect a potential importance of variants detected at lower frequencies.
We found mutations at six positions within the NS3 protease to be associated with different levels of resistance to boceprevir. Initially, when using a population-based sequence analysis, only one mutation at position V170 was detected in a single patient in the study. This highlights the ability of clonal sequencing to provide more information about the resistance profile of STAT-C drugs than population sequencing. In addition to boceprevir-resistant mutations previously identified in the replicon system (T54A, A156S, V170A), mutations at several other positions were identified within the NS3 protease based on an increased frequency at the end of treatment followed by a decline thereafter. Phenotypic characterization of all potential resistance mutations identified by clonal sequencing and frequency analysis identified six loci that were clearly associated with resistance to boceprevir (V36, T54, V55, R155, A156, V170). Presence of these variants already at baseline at high frequencies (20% to 25%) was excluded by population-based sequencing in the present study and is highly unlikely at frequencies around 5% based on the results of a previous study with clonal sequencing at baseline.[19]
The results of this study are consistent with previous in vitro studies[15][17][18][28] showing that the cross-resistance profiles of the two linear peptidomimetic ketoamides boceprevir and telaprevir are largely overlapping. Furthermore, previously described differences of variants selected by genotype 1a or 1b HCV subtypes only, were confirmed. However, differences between the frequencies of specific resistance mutations have been observed in the clinical monotherapy studies of boceprevir and telaprevir. These differences in mutation frequency may be related to the different drugs as well as differences in the patient populations and the doses used in the studies. In treatment-naïve and previously treated patients who received telaprevir at doses of 450 mg every 8 hours, 750 mg every 8 hours, or 1,250 mg every 12 hours, approximately 90% of clones sequenced from end of treatment samples contained resistant variants.[19] In the present study of interferon nonresponder patients who received boceprevir monotherapy at doses of 400 mg BID or TID, a mean frequency of 85.9% of clones contained wild-type NS3 protease sequence at the end-of-treatment. Overall, the frequency of resistant variants was associated with viral load decline. In patients with a maximum decline of HCV-RNA concentrations of at least 2 log10 steps, resistant variants were observed more frequently than in those with a less pronounced decline. The A156S variant, which has a medium level of resistance but low fitness, was observed only in patients with a 2 log10 decline in HCV-RNA concentrations. Interestingly, the A156T variant, which confers the highest level of resistance but exhibits the lowest fitness, was not detected in the patients treated with boceprevir 400 mg TID or BID. The mean viral decline of boceprevir in the present study was lower than that in the phase 1b monotherapy study for different doses of telaprevir.[8][20] In subsequent phase 2 studies as well as the currently ongoing phase 3 study, boceprevir is dosed with 800 mg TID in combination with peginterferon and ribavirin. Moreover, the probability of selection of resistant variants followed by a viral breakthrough is significantly reduced by combination therapy of NS3 protease inhibitors with peginterferon and ribavirin[7][13][14][27] and potentially by the addition of a lead-in phase with peginterferon and ribavirin alone. To answer these questions, results of resistance analysis from the phase 2b studies (SPRINT-1, PROVE1/2) have to be awaited.
In addition, several amino acid mutations frequently detected in the patients treated with boceprevir showed some differences in resistance to telaprevir. T54A was detected more frequently in boceprevir treated patients despite a similar resistance profile (less than two-fold difference) in the replicon assay. V170A mutations conferred a higher level of resistance to boceprevir in comparison with telaprevir in the phenotypic assay, and this variant was frequently detected in boceprevir-treated patients but was not described to be a frequent variant in patients who received telaprevir monotherapy.[19] In contrast, mutation A156S conferred a higher level of resistance to telaprevir than boceprevir.[18] As previously observed for telaprevir, the frequency of resistant variants at the end of treatment generally decreased during follow-up in patients treated with boceprevir.[19]
In the present study, V55A was identified as a new variant to be associated with resistance in patients treated with boceprevir. Resistance to boceprevir by the V55A variant as well as telaprevir with a relative low IC50 was confirmed in the phenotypic assay. However, V55A was not described to be selected during telaprevir monotherapy or combination therapy with peginterferon in phase 1 trials.[19][27] Phenotypic characterization showed slightly higher resistance in replicon assay (6.9-fold versus 3.1-fold) as well as in enzyme assay (4.2-fold versus 2.7-fold) for V55A to boceprevir than to telaprevir. In silico analysis showed that interaction between V55A and S139 or R155 may be responsible for impaired binding of boceprevir. Studies of larger population of patients treated with boceprevir or telaprevir will be required to fully understand the clinical emergence of this novel mutation.
In the present study, only the NS3 protease gene was sequenced. Thus, it is unclear to which extent mutations within the NS4A cofactor and/or at the NS3/4A protease cleavage sites may contribute to confer resistance or to compensation of impaired NS3/4A function. Mutations outside the NS3 protease are not anticipated, and in a recent study of telaprevir in combination with peginterferon and ribavirin, no mutations at the cleavage sites have been detected.[29]
Taken together, during boceprevir monotherapy with 400 mg BID and TID resistance mutations at six positions within the NS3 protease (V36M/A, T54A/S, V55A, R155K/T, A156S, V170A) were detected by a highly sensitive, clonal sequencing method. Generally, mutations were observed at relative low frequencies within the HCV virus population and a strong correlation of the presence of resistant variants with a more pronounced decline of HCV-RNA concentrations was observed. All detected variants showed cross-resistance to telaprevir in the phenotypic assay. However, differences for frequency of detection and/or resistance levels between boceprevir and telaprevir were observed, and this was mainly true for the T54A and V170A mutations. Also, the newly described V55A variant seems to be selected in boceprevir-treated patients only. Impaired viral fitness of single resistant variants was estimated in a mathematical model while combined mutations showed a relative increase of replication efficiency. Further detailed analyses are required to determine the potential long-term persistence of the observed variants and to characterize resistant mutations selected during treatment with higher doses of boceprevir in combination with peginterferon and ribavirin.
Results
Virologic Response
The samples analyzed in this study were obtained from 22 nonresponder (to previous standard treatment) patients infected with HCV subtype 1a (n = 8) or 1b (n = 14) who were dosed for 14 days with boceprevir in a randomized, placebo-controlled double-blind, phase 1 study (Table 1). Patients who received 400 mg boceprevir BID or TID had a decline of up to 3 log10 HCV-RNA IU/mL. The patients were divided into two groups according to virologic response: (1) patients with a maximum decline 2 log10 HCV-RNA IU/mL (n = 15) and (2) patients with a maximum decline <2 log10 HCV-RNA IU/mL (n = 7). Fig. 1C shows viral kinetics for these two groups, which are also separated for the different subtypes. Samples for sequence analysis were obtained at baseline, at end of treatment (day 14), and at end of follow-up (day 28).
Table 1. Distribution of Known Resistance Mutations Occurring at End of Therapy (HCV-RNA Decline <2 log10 IU/mL; HCV RNA decline >/=2 log10 IU/mL)
Picture 12.png
Picture 13.png
Genotypic Resistance Analysis
No resistant variants were observed by population sequencing in baseline samples. Generally, a relatively high genetic heterogeneity was observed within the HCV virus population at the end of treatment. Based on a mean difference of more than 5% within the HCV virus population when compared with baseline samples, altogether mutations at 31 amino acid positions within the NS3 protease were detected: 7, 8, 14, 18, 33, 36, 46, 48, 49, 54, 55, 61, 71, 72, 80, 86, 87, 91, 117, 119, 122, 127, 131, 146, 147, 153, 155, 156, 170, 174, and 179. A restriction to mutations detectable in more than one patient still resulted in changes at 19 amino acid positions of the NS3 protease. Thus, further analysis was restricted to mutations that were observed in more than one patient and showed a decline in frequency during follow-up (n = 9).
The following mutations were observed at amino acid positions that have been shown to be associated with resistance to other protease inhibitors: V36M/A (three patients), T54S/A (10 patients), R155K/T/P (six patients), A156S (three patients), and V170A/L (five patients); these changes occur either as single mutations or as double mutations (V36M + T54S, V36A + R155K, T54S/A + R155K, and T54S + A156S each in one patient). Amino acid mutations V36M and R155K/T were detected only in subtype 1a isolates, presumably because two nucleotide substitutions are required to create these amino acid changes in subtype 1b isolates. Interestingly, no mutations were observed at position R155 in subtype 1b isolates with the exception of a single clone with R155P in one patient.
In addition, we detected four amino acid sites with novel mutations (V48I, V55A, T72I, and I153V) with so far unknown clinical significance for resistance to a protease inhibitor. Selection of V170A and T72I was restricted to subtype 1b patients. Subtype 1a patients all carried I170 and I72 as wild-type amino acids.
Irrespective of variants which are detectable in a specific HCV subtype only (see above) generally, the frequency of resistant variants detected in subtype 1a and subtype 1b patients was similar.
Distribution of Mutations according to Virologic Response
Patients with a Maximum Decline >/=2 log10 HCV-RNA IU/mL.
The mean frequency of mutations versus baseline samples at positions V36 (1.4%), T54 (5.0%), R155 (6.9%), A156 (0.8%), and V170 (3.9%) was 18% at the end of treatment in patients with a maximum HCV-RNA decline of 2 log10. The frequency of mutations at these positions declined to 6% by the end-of-follow-up (P = 0.05). No mutations at position A156 were detected at the end of follow-up. The mean frequency of the potentially new resistance mutations at positions V48, V55, T72, and I153 was 15% at the end of treatment and declined to 10% at the end of follow-up (P > 0.2) (Fig. 1A).
Patients with a Maximum Decline <2 log10 HCV-RNA IU/mL.
In this group of patients, the mean frequency of known (7% at end of treatment) as well as potentially new resistance mutations (4% at end of treatment) decline to 1% by day 28 (P > 0.2 and P = 0.06, respectively) (Fig. 1B).
Overall, irrespective of viral kinetics in 7 of 22 and 9 of 22 patients, only wild-type variants without any resistance mutations at positions V36, T54, V55, R155, A156, and V170 were detected at end of treatment and end of follow-up, respectively. For two patients, long-term follow-up serum samples were available, and no resistant variants have been detected by clonal sequencing in either of these patients 2.5 to 4 years after the end of treatment.
Phenotypic Resistance Analysis
Replicon IC50 values from the known and the potentially new mutations are shown in Fig. 2A. As expected, a change at position 156 (A156T) conferred high-level resistance (>120-fold increase in IC50) against boceprevir, whereas changes at positions 36, 54, 155, 156, and 170 conferred low to moderate resistance (3.8- to 17.7-fold change in IC50). Three of the four newly detected variants (V48I, T72I, and I153V) did not differ from wild-type IC50. However, the substitution from valine to alanine at position 55 showed a clear increase in resistance in the replicon model (6.9-fold). Resistance of the V55A mutation to boceprevir was also confirmed using the in vitro enzymatic assay for NS3 protease (Table 2).
Cross-resistance to Telaprevir
For mutations at several amino acid positions (V36, T54, R155, A156), previously reported resistance at different levels against telaprevir[19][21] was confirmed in the present study. In addition, cross-resistance to telaprevir was shown for mutations at position V170 and for the newly characterized mutation V55A (Fig. 2B). A direct comparison of the IC50 values of both compounds is shown in Fig. 3. Rank correlation between the IC50 values was 0.82 (P = 0.002).
Mathematical Modeling of Relative in Vivo Fitness of Resistant Variants
Replicative fitness of individual NS3 resistant variants was estimated based on mutational frequencies, phenotypic resistance levels and viral kinetics. The fitting procedure using all patient data converged. In addition to relative fitness levels, estimates also were obtained for infected cell loss rate with a median of 0.11 per day (quartiles: 0.03 and 0.24 per day) and a median treatment efficiency in wild-type of 96.7% (quartiles: 94.4% and 98.6%). The viral kinetic modeling method provides an estimate of the fitness of each NS3-resistant variant based on that variant's replacement frequency relative to other NS3 variants (including wild-type) identified within the population.
Overall, an inverse correlation between the resistance potential and the fitness of variants with single mutations can be observed (rank correlation: -0.762, P = 0.037). Amino acid changes at position 156 conferred the highest level of resistance but had the lowest relative fitness (Fig. 4). As described, relative fitness increased if the variant carried a second resistance mutation (i.e., V36A + R155K).[19] No differences were observed for subtypes 1a and 1b. Globally fitted values of estimated relative fitness for all reported mutations are shown in Table 3.
In silico Analysis
Results from in silico analysis are described in the Supporting Information.
Patients and Methods
Patient Population and Study Design.
Forty-six patients were enrolled into a randomized, double-blind, placebo-controlled, 14-day multiple dose, phase 1b trial and received one of the following doses of boceprevir: 100 mg every 12 hours (12 patients), 200 mg every 12 hours (11 patients), 400 mg every 12 hours (11 patients), 400 mg every 8 hours (12 patients), or placebo. For the present study, patients who received the highest dose (400 mg) every 12 hours (BID) or every 8 hours (TID) were selected because with the lower doses only weak virologic responses have been observed (approximately 0.5 log decline). All patients had a chronic hepatitis C with plasma HCV-RNA levels of 7 � 104 IU/mL or greater and negative hepatitis B antigen and antibodies to human immunodeficiency virus 1 and 2. Written informed consent was obtained from each patient in accordance with the 1975 Declaration of Helsinki. For HCV-RNA determination and genotypic analysis presented in this report, serum samples were collected and subsequently stored at -80�C from all patients before dosing (baseline), at the end of dosing (day 14), and 14 days after the end of treatment (follow-up). HCV-RNA was measured by extracting total RNA from the sample and using an in-house real-time reverse-transcription polymerase chain reaction (PCR) assay.
Amplification and Sequencing of the Gene Encoding the HCV NS3 Protease.
Amplification of the complete region encoding the NS3 protease catalytic domain was performed as described by Sarrazin et al.[19] In genotype 1a samples, a 620-bp fragment was amplified by using the following primers: NS3-1a-1s, CCGGGAGATACTGCTCGGAC; NS3-1a-2s, CCGATGGAATGGTCTCCAAGG; NS3-1a-1a, GCTCTGGGGCACTGCTG; and NS3-1a-2a, GAGAGGAGTTGTCCGTGAACAC. A mean number of 47 clones were amplified and sequenced per patient for end of treatment and end of follow-up at J. W. Goethe University Hospital (lower limit of variant detection of 7% with a 95% confidence interval). Population sequencing was performed on baseline samples. The molecular clones and the amplified baseline samples were subjected to sequence PCR according to the manufacturer's instructions using the M13 forward or M13 reverse primers (BigDye Deoxy Terminators; Applied Biosystems, Foster City, CA). Sequencing was performed by an automat (3100 DNA Sequencer; Applied Biosystems, Foster City, CA).
Sequence Alignment and Analysis.
Sequences for the N-terminal 543 nucleotides (181 amino acids) of the NS3 protease were aligned and analyzed for mutations using the software Mutational Surveyor (SoftGenetics, State College, PA). Mean frequencies of mutations at end-of-treatment and end-of-follow-up were calculated for each patient compared with the respective baseline consensus sequence. For a summary of all patients with similar viral kinetics (< versus 2 log10 maximum decline), mean mutations frequencies were calculated based on the results from single patients. GenBank accession numbers: the GenBank accession numbers for the baseline consensus sequences of the NS3 protease of the 22 patients of the present study are GQ500976-GQ500997.
Determination of the Mutant Replicon IC50 and IC90.
Generation of HCV replicon cells and IC50 determination of antiviral agents in the HCV replicon assay was described by Welsch et al.[21] Point mutations were generated with the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions.
All mutational replicon assays were based on the Con-1 backbone (HCV subtype 1b) even for variants which were detected mainly or exclusively in subtype 1a patients and were performed at J. W. Goethe University Hospital. HCV replicon cells were seeded in a 24-well plate at a density of 2 � 104 cells per well in Dulbecco's modified Eagle's medium with 10% fetal bovine serum. The level of HCV-RNA in replicon cells was determined by a real-time quantitative reverse-transcription PCR assay (Taqman) on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA). The IC50/IC90 was defined as the concentration of compound at which the HCV-RNA level in the replicon cells was reduced by 50%/90%. The IC50 and IC90 values of boceprevir and telaprevir were calculated by curve-fitting of the dose-response curves. The boceprevir replicon IC50 phenotype mean values are based on at least two independent experiments.
Determination of the Mutant Enzyme IC50 of the V55A Variant.
All enzyme assays were performed at Schering Plough Research Institute. Introduction of the point mutation was described above. The parental plasmid expressing His-tagged single chain NS4A-NS3 protease domain, NS4A21-32-GSGS-NS33-181, as well as the expression and purification protocol was described by Taremi et al.[22] Recombinant proteases were tested using a chromogenic assay as described by Zhang et al.[23] The overall inhibition constant Ki* (where vs = VmaxS / (Km(1 + 1/Ki*))) was used to measure inhibitor potency.
Fitness Analysis.
The multiple kinetic model is described by a differential equation system, which models the behavior of both wild-type and resistant viral variants similar to a multiple variant viral dynamic model to estimate fitness of HCV genotype 1-resistant variants in subjects dosed with telaprevir.[24][25] The differential equation system has three types of compartments, namely target cells (T), infected cells (Ií), and virus in plasma (Vi) where i {1,K, K}. The dependencies between the different compartments are modeled by a differential equation system:
Here, is the infection rate, the degradation rate of infected cells which was bounded from below by 0.01, p the production rate of wild-type virus, c the viral clearance rate, mji the mutation rate from the jth variant to ith variant during one life-cycle step, and, finally, j and fj are the efficacies of the drug for the variants and the relative fitnesses of the variant, respectively. The model uses specific fitness parameters for each variant and treatment efficacies are derived from the individual wild-type efficacy and in vitro replicon IC50 and IC90 values of the variants. Further viral kinetic parameters such as viral clearance, infected-cell loss, and de novo infection rates are assumed to be identical for all variants but can be patient-specific. The model also accounts for a shared and limited HCV replication space by assuming that the total number of infected and uninfected target cells is constant (L). The model was fitted to all HCV patient data (daily HCV-RNA concentrations from day 1 to 14 and at day 28) simultaneously using a maximum likelihood approach iterating between fitting individual parameters on one hand and global variant fitnesses on the other hand. This iteration and the objective function were implemented in MATLAB (MathWorks, Inc., Natick, MA).
In Silico Analysis.
Methods used for in silico analysis are described in the Supporting Information.
Statistical Analysis.
Continuous variables were compared with Wilcoxon paired sample test and Spearman rank correlation coefficients were calculated. All tests were two-tailed for a significance level of 0.05. Statistical analyses were done using SPSS for Windows, release 16 (SPSS Inc, Chicago, IL).
Cetuximab Boosts Chemo in Colorectal Liver Mets
Cetuximab Boosts Chemo in Colorectal Liver Mets
By Michael Smith, North American Correspondent, MedPage Today
Published: November 25, 2009
Reviewed by Zalman S. Agus, MD; Emeritus Professor
University of Pennsylvania School of Medicine and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner Earn CME/CE credit
for reading medical news
Adding a biological agent to standard chemotherapy in difficult-to-treat cases of colorectal liver metastases significantly improved responses, researchers said.
In a randomized, Phase II study of patients whose tumors were initially considered inoperable, the approach also significantly increased the number of patients who were able to have surgery, according to Gunnar Folprecht, MD, of University Hospital Carl Gustav Carus in Dresden, Germany, and colleagues.
The regimen was "generally found to be tolerable," the researchers reported online in The Lancet, although 72% of patients had grade 3 or worse toxicities.
Action Points
The findings come from a study of 111 patients whose colorectal cancer had been surgically removed, but who developed liver metastases that were regarded as nonresectable.
Such patients have a poor prognosis, the researchers said, but earlier research had suggested that neoadjuvant chemotherapy based on irinotecan (Camptosar) or oxaliplatin (Eloxatin) could shrink tumors and consequently make surgery possible.
Since many colorectal liver metastases express the epidermal growth factor receptor (EGFR), the researchers decided to test the effect of adding cetuximab (Erbitux) to the chemotherapy.
Cetuximab is a monoclonal antibody, administered by intravenous infusion, that inhibits the EGFR receptor.
Patients were randomly assigned to get either irinotecan- or oxaliplatin-based chemotherapy, with the addition of cetuximab, and were followed for up to two years, with surgeons regularly re-evaluating whether surgery was possible.
While the main study was not blinded, the researchers carried out a retrospective blinded surgical review of 68 patients who had MRI and CT scans at baseline and during treatment.
Folprecht and colleagues found:
* An objective complete or partial response in 62% of patients, with no significant difference between the groups
* 36 of 106 evaluable patients were eventually able to have surgery with no margins left -- so-called R0 surgery -- while another 13 had microscopic margins and/or radiofrequency ablation
The blinded review found that treatment with cetuximab significantly increased the proportion of tumors that were amenable to surgery -- 60% were judged to be resectable after treatment compared with 32% at the start of the study.
The difference was statistically significant at P=0.0001.
Review also found that response was higher in patients with KRAS wild-type tumors than in patients whose KRAS gene was mutated, 70% versus 41%, which was significant at P=0.008
The researchers also found a significant benefit for patients whose tumors contained the wild types of KRAS and another gene, BRAF, compared with those who had either one mutated.
Of the 64 patients with both wild types, 46 responded to therapy, compared with 12 of 30 patients who had a mutation in either. The difference was significant at P=0.003.
Recent research has shown that activating mutations in either gene results in increased resistance to EGFR inhibitors, the researchers noted.
"The 70% response rate in patients with a KRAS wild-type tumor is very encouraging," said Sabine Tejpar, MD, PhD, of the Catholic Hospital of Leuven in Leuven, Belgium, and colleagues in an accompanying comment article.
The finding "consolidates" results from earlier studies, they said, and opens the door to studies that look at such clinically important endpoints as overall survival.
The study was supported by Merck-Serono, sanofi-aventis, and Pfizer. Folprecht reported financial links with Merck Serono, Pfizer, sanofi-aventis, Roche, Abbott, and Amgen. Other authors also reported potential conflicts
The comment authors declared no conflicts of interest.
Primary source: The Lancet Oncology
Source reference:
Folprecht G, et al "Tumour response and secondary resectability of colorectal liver metastases following neoadjuvant chemotherapy with cetuximab: the CELIM randomised phase 2 trial" Lancet Oncol 2009; DOI: 10.1016/S1470-2045(09)70330-4.
Additional source: The Lancet Oncology
Source reference:
Tejpar S, et al "Improved first-line chemotherapy: a better chance for surgery?" Lancet Oncol 2009; DOI: 10.1016/S1470-2045(09)70345-6.
By Michael Smith, North American Correspondent, MedPage Today
Published: November 25, 2009
Reviewed by Zalman S. Agus, MD; Emeritus Professor
University of Pennsylvania School of Medicine and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner Earn CME/CE credit
for reading medical news
Adding a biological agent to standard chemotherapy in difficult-to-treat cases of colorectal liver metastases significantly improved responses, researchers said.
In a randomized, Phase II study of patients whose tumors were initially considered inoperable, the approach also significantly increased the number of patients who were able to have surgery, according to Gunnar Folprecht, MD, of University Hospital Carl Gustav Carus in Dresden, Germany, and colleagues.
The regimen was "generally found to be tolerable," the researchers reported online in The Lancet, although 72% of patients had grade 3 or worse toxicities.
Action Points
The findings come from a study of 111 patients whose colorectal cancer had been surgically removed, but who developed liver metastases that were regarded as nonresectable.
Such patients have a poor prognosis, the researchers said, but earlier research had suggested that neoadjuvant chemotherapy based on irinotecan (Camptosar) or oxaliplatin (Eloxatin) could shrink tumors and consequently make surgery possible.
Since many colorectal liver metastases express the epidermal growth factor receptor (EGFR), the researchers decided to test the effect of adding cetuximab (Erbitux) to the chemotherapy.
Cetuximab is a monoclonal antibody, administered by intravenous infusion, that inhibits the EGFR receptor.
Patients were randomly assigned to get either irinotecan- or oxaliplatin-based chemotherapy, with the addition of cetuximab, and were followed for up to two years, with surgeons regularly re-evaluating whether surgery was possible.
While the main study was not blinded, the researchers carried out a retrospective blinded surgical review of 68 patients who had MRI and CT scans at baseline and during treatment.
Folprecht and colleagues found:
* An objective complete or partial response in 62% of patients, with no significant difference between the groups
* 36 of 106 evaluable patients were eventually able to have surgery with no margins left -- so-called R0 surgery -- while another 13 had microscopic margins and/or radiofrequency ablation
The blinded review found that treatment with cetuximab significantly increased the proportion of tumors that were amenable to surgery -- 60% were judged to be resectable after treatment compared with 32% at the start of the study.
The difference was statistically significant at P=0.0001.
Review also found that response was higher in patients with KRAS wild-type tumors than in patients whose KRAS gene was mutated, 70% versus 41%, which was significant at P=0.008
The researchers also found a significant benefit for patients whose tumors contained the wild types of KRAS and another gene, BRAF, compared with those who had either one mutated.
Of the 64 patients with both wild types, 46 responded to therapy, compared with 12 of 30 patients who had a mutation in either. The difference was significant at P=0.003.
Recent research has shown that activating mutations in either gene results in increased resistance to EGFR inhibitors, the researchers noted.
"The 70% response rate in patients with a KRAS wild-type tumor is very encouraging," said Sabine Tejpar, MD, PhD, of the Catholic Hospital of Leuven in Leuven, Belgium, and colleagues in an accompanying comment article.
The finding "consolidates" results from earlier studies, they said, and opens the door to studies that look at such clinically important endpoints as overall survival.
The study was supported by Merck-Serono, sanofi-aventis, and Pfizer. Folprecht reported financial links with Merck Serono, Pfizer, sanofi-aventis, Roche, Abbott, and Amgen. Other authors also reported potential conflicts
The comment authors declared no conflicts of interest.
Primary source: The Lancet Oncology
Source reference:
Folprecht G, et al "Tumour response and secondary resectability of colorectal liver metastases following neoadjuvant chemotherapy with cetuximab: the CELIM randomised phase 2 trial" Lancet Oncol 2009; DOI: 10.1016/S1470-2045(09)70330-4.
Additional source: The Lancet Oncology
Source reference:
Tejpar S, et al "Improved first-line chemotherapy: a better chance for surgery?" Lancet Oncol 2009; DOI: 10.1016/S1470-2045(09)70345-6.
Patients with Nonalcoholic Liver Disease Qualify for Transplan
Patients with Nonalcoholic Liver Disease Qualify for Transplant
By Kristina Fiore, Staff Writer, MedPage Today
Published: November 25, 2009
Reviewed by Dori F. Zaleznik, MD; Associate Clinical Professor of Medicine, Harvard Medical School, Boston and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner Earn CME/CE credit
for reading medical news
Action Points
In a retrospective study, there were no significant differences between patients with NASH and those with alcoholic cirrhosis in post-transplant mortality (27% versus 17%, P=0.17) and cardiovascular mortality (26% versus 7%, P=0.21), Vishal Bhagat, MD, of the University of Miami, and colleagues reported in the December issue of Liver Transplantation.
More NASH patients did die from cardiovascular causes than alcoholic cirrhosis patients, although the difference was not statistically significant.
"Cryptogenic cirrhosis with the NASH phenotype is an acceptable indication for liver transplant, with post-transplant survival rates similar to those for other causes of cirrhosis," the researchers concluded.
"Aggressive control of metabolic syndrome may have some role in the post-transplant management of these patients, not only to prevent disease recurrence in the transplanted liver but also to prevent cardiovascular mortality."
Nonalcoholic steatohepatitis is becoming a common cause of liver cirrhosis requiring liver transplantation, the researchers said. Yet prognosis and post-transplant outcomes of NASH cirrhosis have not been well defined.
So investigators conducted a retrospective chart review of all liver transplant patients at the University of Miami from January 1997 to January 2007. There were a total of 1,705 cases, but the researchers focused on 71 patients with NASH and 83 patients with alcoholic cirrhosis.
The researchers said components of metabolic syndrome were significantly more prevalent in the NASH group.
Although there was a trend toward lower survival in the NASH group, it was not statistically significant. One-, three-, five-, and nine-year patient survival probabilities were 82%, 79%, 75%, and 62% in the NASH group and 92%, 86%, 86%, and 76% in the alcoholic cirrhosis group.
Sepsis was the leading cause of post-transplant death in both groups, followed by cardiovascular causes in the NASH group and malignancies in the alcoholic cirrhosis group.
A higher number of patients died from cardiovascular causes in the NASH group than in the alcoholic cirrhosis group. Although the difference wasn't statistically significant, they noted, "cardiovascular mortality in our NASH group was much higher than that based on published autopsy results for liver transplant patients."
While there was no difference in graft failure between the two groups, acute rejection and recurrent steatohepatitis were significantly more frequent in the NASH group.
More patients in the NASH group had biopsy-proven acute rejection (41% versus 23%, P=0.023).
And no patients in the alcoholic cirrhosis group had disease recurrence, but 33% of patients in the NASH group showed moderate to severe recurrence of steatohepatitis in liver biopsy specimens.
Yet these findings did not lead to higher rates of retransplantation, the researchers said.
"Although there were higher rates of acute rejections and recurrent steatohepatitis in the NASH group, graft survival and retransplantation rates were not different," they concluded. "We have shown that NASH cirrhosis is an acceptable indication for liver transplantation, with graft and patient survival rates comparable to those for other causes of cirrhosis."
They noted that the study was limited by: its retrospective design, a relatively small number of patients, the definition of NASH based on clinical parameters of metabolic syndrome, and absence of data on immunosuppressive regimens and post-transplant liver biopsies to judge disease recurrence rates.
The researchers reported no conflicts of interest.
Primary source: Liver Transplantation
Source reference:
Bhagat V, et al "Outcomes of liver transplantation in patients with cirrhosis due to nonalcoholic steatohepatitis versus patients with cirrhosis due to alcoholic liver disease" Liver Transpl 2009; 15: 1814-20.
By Kristina Fiore, Staff Writer, MedPage Today
Published: November 25, 2009
Reviewed by Dori F. Zaleznik, MD; Associate Clinical Professor of Medicine, Harvard Medical School, Boston and
Dorothy Caputo, MA, RN, BC-ADM, CDE, Nurse Planner Earn CME/CE credit
for reading medical news
Action Points
In a retrospective study, there were no significant differences between patients with NASH and those with alcoholic cirrhosis in post-transplant mortality (27% versus 17%, P=0.17) and cardiovascular mortality (26% versus 7%, P=0.21), Vishal Bhagat, MD, of the University of Miami, and colleagues reported in the December issue of Liver Transplantation.
More NASH patients did die from cardiovascular causes than alcoholic cirrhosis patients, although the difference was not statistically significant.
"Cryptogenic cirrhosis with the NASH phenotype is an acceptable indication for liver transplant, with post-transplant survival rates similar to those for other causes of cirrhosis," the researchers concluded.
"Aggressive control of metabolic syndrome may have some role in the post-transplant management of these patients, not only to prevent disease recurrence in the transplanted liver but also to prevent cardiovascular mortality."
Nonalcoholic steatohepatitis is becoming a common cause of liver cirrhosis requiring liver transplantation, the researchers said. Yet prognosis and post-transplant outcomes of NASH cirrhosis have not been well defined.
So investigators conducted a retrospective chart review of all liver transplant patients at the University of Miami from January 1997 to January 2007. There were a total of 1,705 cases, but the researchers focused on 71 patients with NASH and 83 patients with alcoholic cirrhosis.
The researchers said components of metabolic syndrome were significantly more prevalent in the NASH group.
Although there was a trend toward lower survival in the NASH group, it was not statistically significant. One-, three-, five-, and nine-year patient survival probabilities were 82%, 79%, 75%, and 62% in the NASH group and 92%, 86%, 86%, and 76% in the alcoholic cirrhosis group.
Sepsis was the leading cause of post-transplant death in both groups, followed by cardiovascular causes in the NASH group and malignancies in the alcoholic cirrhosis group.
A higher number of patients died from cardiovascular causes in the NASH group than in the alcoholic cirrhosis group. Although the difference wasn't statistically significant, they noted, "cardiovascular mortality in our NASH group was much higher than that based on published autopsy results for liver transplant patients."
While there was no difference in graft failure between the two groups, acute rejection and recurrent steatohepatitis were significantly more frequent in the NASH group.
More patients in the NASH group had biopsy-proven acute rejection (41% versus 23%, P=0.023).
And no patients in the alcoholic cirrhosis group had disease recurrence, but 33% of patients in the NASH group showed moderate to severe recurrence of steatohepatitis in liver biopsy specimens.
Yet these findings did not lead to higher rates of retransplantation, the researchers said.
"Although there were higher rates of acute rejections and recurrent steatohepatitis in the NASH group, graft survival and retransplantation rates were not different," they concluded. "We have shown that NASH cirrhosis is an acceptable indication for liver transplantation, with graft and patient survival rates comparable to those for other causes of cirrhosis."
They noted that the study was limited by: its retrospective design, a relatively small number of patients, the definition of NASH based on clinical parameters of metabolic syndrome, and absence of data on immunosuppressive regimens and post-transplant liver biopsies to judge disease recurrence rates.
The researchers reported no conflicts of interest.
Primary source: Liver Transplantation
Source reference:
Bhagat V, et al "Outcomes of liver transplantation in patients with cirrhosis due to nonalcoholic steatohepatitis versus patients with cirrhosis due to alcoholic liver disease" Liver Transpl 2009; 15: 1814-20.
Vitamin D: A potential role in cardiovascular disease prevention
Vitamin D: A potential role in cardiovascular disease prevention
NOVEMBER 24, 2009 | Lisa Nainggolan http://www.theheart.org
Orlando, FL - Inadequate levels of vitamin D are associated with an increase in the risk of cardiovascular disease and death, a new observational study has found. Dr Tami L Bair (Intermountain Medical Center, Murray, UT) reported the findings here at the American Heart Association 2009 ScientificSessions.
Bair and colleagues followed more than 27 000 people 50 years or older with no history of cardiovascular disease for just over a year and found that those with very low levels of vitamin D (<15 ng/mL) were 77% more likely to die, 45% more likely to develop coronary artery disease, and 78% more likely to have a stroke than those with normal levels (>30 ng/mL). Those deficient in vitamin D were also twice as likely to develop heart failure as those with normal levels.
"We concluded that even a moderate deficiency of vitamin D was associated with developing coronary artery disease, heart failure, stroke, and death," said coauthor Dr Heidi May (Intermountain Medical Center). However, "it is not known whether this is a cause and effect relationship," she told heartwire. Because this study was observational, more research is needed "to better establish the association between vitamin D deficiency and cardiovascular disease," she noted.
Evidence so far suggestive of benefit of vitamin D
Vitamin D was the subject of much discussion in a general session on vitamins at the AHA scientific sessions. Although the evidence supporting the benefits of vitamin D in cardiovascular disease is probably stronger than for any other vitamin, there have been only a few randomized clinical trials, and previous observational studies "show no robust effects," said Dr Harald Dobnig (Medical University of Graz, Austria). The latter suffer from limitations, such as doses of vitamin D supplementation that are too low, low compliance rates, and short study duration, he noted.
There are some large randomized trials underway looking at outcomes with vitamin D; it is hoped that they will provide definitive answers in five to seven years, Dr Eric Rimm (Harvard School of Public Health, Boston, MA) explained.
"I think there's promise for vitamin D. We know that most people have insufficient vitamin D levels in their blood," Rimm told heartwire. "So although it will take five years until some of the trials that are adequately powered to look at cardiovascular disease with vitamin D will report, the epidemiology right now is suggestive that people should have 1000 or 2000 IU of vitamin D a day," he said.
Vitamin D: How do we get it, and how much is enough?
Rimm discussed vitamin D at length, explaining that there are two sources: sunlight in the form of UVB rays, and diet (foods and supplementation). "Many tissue types and cells in the body have vitamin D receptors, and the active form of vitamin D is modulated by calcium and parathyroid hormone," he explained, with potential downstream effects on a number of bodily systems—inflammatory markers and the renin angiotensin system to name just two—he said.
People at highest risk of vitamin D deficiency include those with darker skin, those living at high altitudes, the elderly (because there is less of the precursor for vitamin D in the blood as people age and older people tend to spend less time outside), the obese, those who avoid the sun or cover the skin in the sun, those who are the immobilized or institutionalized, and pregnant and breast-feeding women.
Deficiency in vitamin D is generally agreed to be a blood level of <20 ng/mL, he said, with 20-29 ng/mL indicating insufficient vitamin D, 30-60 ng/mL indicating adequate vitamin D, and >150 ng/mL indicating excessive vitamin D.
Data suggest that many people are likely getting inadequate vitamin D, he said, with studies showing that black Americans have blood levels ranging from 6-18 ng/mL and that white Americans have levels ranging from 16-25 ng/mL.
In general, a supplement of 100 IU of vitamin D per day will increase blood levels of vitamin D by 1 ng/mL, Rimm said. Those taking 1000 IU per day should have blood levels in the range of 25-32 ng/mL and those taking 4000 IU should have levels of 40-50 ng/mL.
Diet and sunshine good sources of vitamin D
However, Rimm stressed that vitamin D need not just come from supplements. "I think for vitamin D, it's a shame just to count on supplementation because, during the right times of year, five to 10 minutes a day of sunlight is sufficient is to make enough vitamin D. I do hear the concerns about skin cancer and I think people should wear suntan lotion, but it's probably better to put it on 10 minutes after you've been in the sun."
He cautioned that "in northern climes, even if you go out in the sun in January, you're not going to make much vitamin D, so there you would need supplementation to get adequate levels."
One of the best dietary sources of vitamin D is fish.
People should remember that diet is an important source of vitamin D, too, he noted. "One of the best dietary sources of vitamin D is fish. We already suggest people eat a couple of servings a week, but having three or four servings a week of fish can get you a fair bit of vitamin D, and would represent an additional 300 to 500 IU of vitamin D. This still might not be sufficient so you might need a little bit of sunlight or to take a vitamin D supplement. It's really a combination of things, that's probably the best approach."
Both Rimm and Dobnig said it is nearly impossible for anyone to suffer adverse effects from too much vitamin D. Those who spend whole days in the sun, such as lifeguards, have vitamin D levels ranging from 45 to 65 ng/mL, said Rimm. "Vitamin D is safe. Hypercalcemia is not a problem, with the rare exception of granulomatous disease," said Dobnig. He added that because vitamin D is a fat-soluble vitamin, it can be given weekly, or even monthly.
Results of two large randomized trials eagerly awaited
Rimm said he hopes ongoing research will inform the vitamin D debate. Data are needed on intermediate end points, such as inflammatory markers and parathyroid hormone, and on "hard" end points, such as coronary artery disease, sudden death, and heart failure, both in primary prevention and in high-risk populations, including those with chronic kidney disease and heart failure.
The results of two large randomized trials are eagerly awaited, he said, including the National Institutes ofHealth-sponsored VITAL study looking at whether 2000 IU vitamin D and/or 1 g of fish oil (omega-3 fatty-acid supplementation) can reduce the risk of developing heart disease, stroke, or cancer in 20 000 men and women, which is slated to begin in January 2010.
The Thiazolidinedione Intervention with Vitamin D Evaluation (TIDE) study is being coordinated by researchers at McMaster University, Hamilton, ON. This trial is looking at rosiglitazone versus pioglitazone in people with type 2 diabetes at risk of heart disease, but also has a vitamin D versus placebo arm. The primary outcome for the vitamin D arm will be cancer, but there are a number of secondary cardiovascular end points, said Dobnig.
Right now, I think the evidence for vitamin D probably is stronger than the evidence for other vitamins.
"The evidence for vitamins is not great," Rimm said. "The best thing we can say now is to stop smoking, eat a good diet, and don't be overweight. I think people sometimes lose touch with the most important message of prevention, and jump right to the vitamins thinking that's going to sustain them, so doing what we know first and best is probably the best place to start."
"After that, right now, I think the evidence for vitamin D probably is stronger than the evidence for other vitamins," he concluded.
No conflicts of interest were declared.
Related links
* Massive vitamin-D/omega-3 trial for CVD, cancer prevention
[Prevention > Prevention; Jun 29, 2009]
* Low vitamin-D levels in adolescents predict CVD risk factors
[Prevention > Prevention; Mar 18, 2009]
NOVEMBER 24, 2009 | Lisa Nainggolan http://www.theheart.org
Orlando, FL - Inadequate levels of vitamin D are associated with an increase in the risk of cardiovascular disease and death, a new observational study has found. Dr Tami L Bair (Intermountain Medical Center, Murray, UT) reported the findings here at the American Heart Association 2009 ScientificSessions.
Bair and colleagues followed more than 27 000 people 50 years or older with no history of cardiovascular disease for just over a year and found that those with very low levels of vitamin D (<15 ng/mL) were 77% more likely to die, 45% more likely to develop coronary artery disease, and 78% more likely to have a stroke than those with normal levels (>30 ng/mL). Those deficient in vitamin D were also twice as likely to develop heart failure as those with normal levels.
"We concluded that even a moderate deficiency of vitamin D was associated with developing coronary artery disease, heart failure, stroke, and death," said coauthor Dr Heidi May (Intermountain Medical Center). However, "it is not known whether this is a cause and effect relationship," she told heartwire. Because this study was observational, more research is needed "to better establish the association between vitamin D deficiency and cardiovascular disease," she noted.
Evidence so far suggestive of benefit of vitamin D
Vitamin D was the subject of much discussion in a general session on vitamins at the AHA scientific sessions. Although the evidence supporting the benefits of vitamin D in cardiovascular disease is probably stronger than for any other vitamin, there have been only a few randomized clinical trials, and previous observational studies "show no robust effects," said Dr Harald Dobnig (Medical University of Graz, Austria). The latter suffer from limitations, such as doses of vitamin D supplementation that are too low, low compliance rates, and short study duration, he noted.
There are some large randomized trials underway looking at outcomes with vitamin D; it is hoped that they will provide definitive answers in five to seven years, Dr Eric Rimm (Harvard School of Public Health, Boston, MA) explained.
"I think there's promise for vitamin D. We know that most people have insufficient vitamin D levels in their blood," Rimm told heartwire. "So although it will take five years until some of the trials that are adequately powered to look at cardiovascular disease with vitamin D will report, the epidemiology right now is suggestive that people should have 1000 or 2000 IU of vitamin D a day," he said.
Vitamin D: How do we get it, and how much is enough?
Rimm discussed vitamin D at length, explaining that there are two sources: sunlight in the form of UVB rays, and diet (foods and supplementation). "Many tissue types and cells in the body have vitamin D receptors, and the active form of vitamin D is modulated by calcium and parathyroid hormone," he explained, with potential downstream effects on a number of bodily systems—inflammatory markers and the renin angiotensin system to name just two—he said.
People at highest risk of vitamin D deficiency include those with darker skin, those living at high altitudes, the elderly (because there is less of the precursor for vitamin D in the blood as people age and older people tend to spend less time outside), the obese, those who avoid the sun or cover the skin in the sun, those who are the immobilized or institutionalized, and pregnant and breast-feeding women.
Deficiency in vitamin D is generally agreed to be a blood level of <20 ng/mL, he said, with 20-29 ng/mL indicating insufficient vitamin D, 30-60 ng/mL indicating adequate vitamin D, and >150 ng/mL indicating excessive vitamin D.
Data suggest that many people are likely getting inadequate vitamin D, he said, with studies showing that black Americans have blood levels ranging from 6-18 ng/mL and that white Americans have levels ranging from 16-25 ng/mL.
In general, a supplement of 100 IU of vitamin D per day will increase blood levels of vitamin D by 1 ng/mL, Rimm said. Those taking 1000 IU per day should have blood levels in the range of 25-32 ng/mL and those taking 4000 IU should have levels of 40-50 ng/mL.
Diet and sunshine good sources of vitamin D
However, Rimm stressed that vitamin D need not just come from supplements. "I think for vitamin D, it's a shame just to count on supplementation because, during the right times of year, five to 10 minutes a day of sunlight is sufficient is to make enough vitamin D. I do hear the concerns about skin cancer and I think people should wear suntan lotion, but it's probably better to put it on 10 minutes after you've been in the sun."
He cautioned that "in northern climes, even if you go out in the sun in January, you're not going to make much vitamin D, so there you would need supplementation to get adequate levels."
One of the best dietary sources of vitamin D is fish.
People should remember that diet is an important source of vitamin D, too, he noted. "One of the best dietary sources of vitamin D is fish. We already suggest people eat a couple of servings a week, but having three or four servings a week of fish can get you a fair bit of vitamin D, and would represent an additional 300 to 500 IU of vitamin D. This still might not be sufficient so you might need a little bit of sunlight or to take a vitamin D supplement. It's really a combination of things, that's probably the best approach."
Both Rimm and Dobnig said it is nearly impossible for anyone to suffer adverse effects from too much vitamin D. Those who spend whole days in the sun, such as lifeguards, have vitamin D levels ranging from 45 to 65 ng/mL, said Rimm. "Vitamin D is safe. Hypercalcemia is not a problem, with the rare exception of granulomatous disease," said Dobnig. He added that because vitamin D is a fat-soluble vitamin, it can be given weekly, or even monthly.
Results of two large randomized trials eagerly awaited
Rimm said he hopes ongoing research will inform the vitamin D debate. Data are needed on intermediate end points, such as inflammatory markers and parathyroid hormone, and on "hard" end points, such as coronary artery disease, sudden death, and heart failure, both in primary prevention and in high-risk populations, including those with chronic kidney disease and heart failure.
The results of two large randomized trials are eagerly awaited, he said, including the National Institutes ofHealth-sponsored VITAL study looking at whether 2000 IU vitamin D and/or 1 g of fish oil (omega-3 fatty-acid supplementation) can reduce the risk of developing heart disease, stroke, or cancer in 20 000 men and women, which is slated to begin in January 2010.
The Thiazolidinedione Intervention with Vitamin D Evaluation (TIDE) study is being coordinated by researchers at McMaster University, Hamilton, ON. This trial is looking at rosiglitazone versus pioglitazone in people with type 2 diabetes at risk of heart disease, but also has a vitamin D versus placebo arm. The primary outcome for the vitamin D arm will be cancer, but there are a number of secondary cardiovascular end points, said Dobnig.
Right now, I think the evidence for vitamin D probably is stronger than the evidence for other vitamins.
"The evidence for vitamins is not great," Rimm said. "The best thing we can say now is to stop smoking, eat a good diet, and don't be overweight. I think people sometimes lose touch with the most important message of prevention, and jump right to the vitamins thinking that's going to sustain them, so doing what we know first and best is probably the best place to start."
"After that, right now, I think the evidence for vitamin D probably is stronger than the evidence for other vitamins," he concluded.
No conflicts of interest were declared.
Related links
* Massive vitamin-D/omega-3 trial for CVD, cancer prevention
[Prevention > Prevention; Jun 29, 2009]
* Low vitamin-D levels in adolescents predict CVD risk factors
[Prevention > Prevention; Mar 18, 2009]
Vitamin D Boosts Treatment of Chronic Hepatitis C
Vitamin D Boosts Treatment of Chronic Hepatitis C
from Jules: I read the late breaker poster presented at AASLD in Nov 2009 and spoke with the author about this study, I think its interesting and vitamin D may help.
Nov 25 209,
http://www.empowher.com
Hepatitis C is an inflammation of the liver caused by the spherical, enveloped single-strand RNA virus. The World Health Organization estimated 170 million individuals worldwide are infected with the hepatitis C virus (HCV). In the U.S., HCV accounts for 20% of all cases of acute (severe and of short duration) hepatitis, an estimated 30,000 new acute infections, and 8000 to 10,000 deaths annually. Chronic (long term) hepatitis C is predominately transmitted by percutaneous (through the skin) exposure to infected blood.
The treatment with most promising results is a combination of pegylated interferon alfa (Pegasys, PEG-Intron) and the antiviral drug, ribavirin (Vitrazole). Interferon alfa is a protein which the human body produces naturally as a defense response to viral infections. Pegylation describes a chemical process that makes the interferon last longer in the body. Interferon increases the potency of ribavirin in the treatment of HCV.
Adding a daily dose of Vitamin D to the regimen of pegylated interferon-alfa 2 and ribavirin might increase the response rates, according to an abstract which was presented at the Liver Meeting 2009, the 60th Annual Meeting of the American Association of the Study of Liver Disease.
"This preliminary study confirms the benefit of adding Vitamin D to conventional antiviral therapy in patients with chronic hepatitis C". states lead investigator, Saif M. Abu-Mouch, MD, from the Department of Hepatology, Hillel Yaffe Medical Center in Hadera, Israel. (1)
In the study, 58 patients, the control group, who were diagnosed with HCV, were randomly assigned to the protocol of peginterferon-alfa 2b 1.5 ug/kg once per week and ribavirin 1000 to 2000 mg daily. Thirty-one patients received the same treatment plus Vitamin D 1000 to 4000 IU daily. By the fourth week of treatment, a rapid virological (pertaining to viruses) response was seen in 44% of the patients who received Vitamin D and in 18% of the control group. At the twelfth week of treatment, 96% of the group who received the addition of Vitamin D and 48% of the control group were HCV RNA negative.
"The study is surprising and promising because Vitamin D is something very easy to use and there is no toxicity. It's also interesting that the group treated with Vitamin D had more severe disease than the control group. I think this can be considered a strong result from a small study", commented Laurent Tsakins, MD. who was an attendee of the meeting. (1)
Maryann Gromisch is a registered nurse, who has working on the medical, surgical, and critical care units of a hospital, and with a gastroenterologist in a private practice setting.
from Jules: I read the late breaker poster presented at AASLD in Nov 2009 and spoke with the author about this study, I think its interesting and vitamin D may help.
Nov 25 209,
http://www.empowher.com
Hepatitis C is an inflammation of the liver caused by the spherical, enveloped single-strand RNA virus. The World Health Organization estimated 170 million individuals worldwide are infected with the hepatitis C virus (HCV). In the U.S., HCV accounts for 20% of all cases of acute (severe and of short duration) hepatitis, an estimated 30,000 new acute infections, and 8000 to 10,000 deaths annually. Chronic (long term) hepatitis C is predominately transmitted by percutaneous (through the skin) exposure to infected blood.
The treatment with most promising results is a combination of pegylated interferon alfa (Pegasys, PEG-Intron) and the antiviral drug, ribavirin (Vitrazole). Interferon alfa is a protein which the human body produces naturally as a defense response to viral infections. Pegylation describes a chemical process that makes the interferon last longer in the body. Interferon increases the potency of ribavirin in the treatment of HCV.
Adding a daily dose of Vitamin D to the regimen of pegylated interferon-alfa 2 and ribavirin might increase the response rates, according to an abstract which was presented at the Liver Meeting 2009, the 60th Annual Meeting of the American Association of the Study of Liver Disease.
"This preliminary study confirms the benefit of adding Vitamin D to conventional antiviral therapy in patients with chronic hepatitis C". states lead investigator, Saif M. Abu-Mouch, MD, from the Department of Hepatology, Hillel Yaffe Medical Center in Hadera, Israel. (1)
In the study, 58 patients, the control group, who were diagnosed with HCV, were randomly assigned to the protocol of peginterferon-alfa 2b 1.5 ug/kg once per week and ribavirin 1000 to 2000 mg daily. Thirty-one patients received the same treatment plus Vitamin D 1000 to 4000 IU daily. By the fourth week of treatment, a rapid virological (pertaining to viruses) response was seen in 44% of the patients who received Vitamin D and in 18% of the control group. At the twelfth week of treatment, 96% of the group who received the addition of Vitamin D and 48% of the control group were HCV RNA negative.
"The study is surprising and promising because Vitamin D is something very easy to use and there is no toxicity. It's also interesting that the group treated with Vitamin D had more severe disease than the control group. I think this can be considered a strong result from a small study", commented Laurent Tsakins, MD. who was an attendee of the meeting. (1)
Maryann Gromisch is a registered nurse, who has working on the medical, surgical, and critical care units of a hospital, and with a gastroenterologist in a private practice setting.
HUMAN GENOME SCIENCES SUBMITS BIOLOGICS LICENSE APPLICATION TO FDA FOR ZALBIN™
HUMAN GENOME SCIENCES SUBMITS BIOLOGICS LICENSE APPLICATION TO FDA FOR ZALBIN™
ROCKVILLE, Maryland – November 25, 2009 – Human Genome Sciences, Inc. (Nasdaq: HGSI) today announced that it has submitted a Biologics License Application (BLA) to the U.S. Food and Drug Administration (FDA) for ZALBIN™ (albinterferon alfa-2b) for the treatment of chronic hepatitis C. The BLA submission includes the results of two pivotal Phase 3 clinical trials showing that 900-mcg albinterferon alfa-2b dosed every two weeks met its primary endpoint of non-inferiority to peginterferon alfa-2a (Pegasys) dosed once each week.
The Phase 3 studies, known as ACHIEVE 1 and ACHIEVE 2/3, evaluated albinterferon alfa-2b vs. peginterferon alfa-2a, in combination with ribavirin, for use in the treatment of interferon-naïve patients with chronic hepatitis C. In both studies, albinterferon alfa-2b, with half the injections, achieved sustained virologic response comparable to that achieved by peginterferon alfa-2a. The rates of serious and/or severe adverse events were also comparable in these studies. ACHIEVE 1 was conducted in patients infected with genotype 1 virus, and ACHIEVE 2/3 was conducted in patients with genotypes 2 or 3 virus. The two studies treated a total of 2255 patients.
“We look forward to continuing to work closely with Novartis to advance albinterferon alfa-2b to the market under the brand name ZALBIN in the United States,” said H. Thomas Watkins, President and Chief Executive Officer, HGS. “Assuming licensure by the FDA and other regulatory agencies, HGS believes ZALBIN could become an important treatment for chronic hepatitis C. Novartis targets submission of marketing authorization applications under the brand name JOULFERON® in the rest of the world later this quarter, beginning with Europe.”
About the Collaboration with Novartis
Under an exclusive worldwide co-development and commercialization agreement entered into in 2006, HGS and Novartis will co-commercialize albinterferon alfa-2b in the United States as ZALBIN™, and will share clinical development costs, U.S. commercialization costs and U.S. profits equally. Novartis will be responsible for commercialization of albinterferon alfa-2b as JOULFERON® in the rest of the world, and will pay HGS a royalty on those sales. These brand names will be subject to confirmation by health authorities at the time of product approval.
HGS has primary responsibility for the bulk manufacture of albinterferon alfa-2b, and Novartis will have responsibility for commercial manufacturing of the finished drug product. Clinical development, commercial milestone and other payments to HGS could total as much as $507.5 million, including $207.5 million received to date. The remaining payments to HGS under the agreement relate to the achievement of certain regulatory approval and commercial milestones.
About ZALBIN (albinterferon alfa-2b)
ZALBIN (also known as JOULFERON) is a genetic fusion of human albumin and interferon alfa created using proprietary HGS albumin-fusion technology. Human albumin is the most prevalent naturally occurring blood protein in the human circulatory system, persisting in circulation in the body for approximately 19 days. Research has shown that genetic fusion of therapeutic proteins to human albumin decreases clearance and prolongs the half-life of the therapeutic proteins.
ZALBIN dosed once every two weeks has completed Phase 3 development. In April 2009, positive Phase 3 results of ZALBIN in patients with chronic hepatitis C were presented at the 44th annual meeting of the European Association for the Study of the Liver in Copenhagen. Data from two pivotal Phase 3 trials, ACHIEVE 1 and ACHIEVE 2/3, showed that ZALBIN met its primary endpoint of non-inferiority to Pegasys (peginterferon alfa-2a). With half the injections, ZALBIN achieved a rate of sustained virologic response comparable to Pegasys in these studies; rates of serious and/or severe adverse events were also comparable.
About Hepatitis C
Hepatitis C is an inflammation of the liver caused by the hepatitis C virus. It is estimated that as many as 170 million people worldwide are infected with hepatitis C virus. This includes nearly four million people in the United States. When detectable levels of HCV persist in the blood for at least six months, a person is diagnosed with chronic hepatitis C. Hepatitis C virus can cause serious liver disease, leading to cirrhosis, primary liver cancer and even death. Patients infected with the genotype 1 hepatitis C virus account for approximately 75% of the chronic hepatitis C patients in the U.S.
About Human Genome Sciences
The mission of HGS is to apply great science and great medicine to bring innovative drugs to patients with unmet medical needs. The HGS clinical development pipeline includes novel drugs to treat lupus, hepatitis C, inhalation anthrax and cancer.
The Company’s primary focus is rapid progress toward the commercialization of its two lead drugs, BENLYSTA™ (belimumab) for lupus and ZALBIN™ (albinterferon alfa-2b) for hepatitis C. Phase 3 development has been completed successfully for both BENLYSTA and Zalbin. The submission of marketing applications for BENLYSTA is planned in the U.S., Europe and other regions in the first half of 2010. A BLA has been submitted for ZALBIN to the FDA in the United States, and Novartis targets submission of marketing authorization applications under the brand name JOULFERON® in the rest of the world, beginning with Europe in fourth quarter 2009.
In April 2009, HGS completed the delivery of 20,000 doses of raxibacumab to the U.S. Strategic National Stockpile for use in the event of an emergency to treat inhalational anthrax. In July 2009, HGS secured a new purchase order for 45,000 doses of raxibacumab to be delivered to the Stockpile over a three-year period beginning near the end of 2009. In May 2009, HGS submitted a Biologics License Application to the FDA for raxibacumab for the treatment of inhalation anthrax.
The Company also has several drugs in earlier stages of clinical development for the treatment of cancer, led by the TRAIL receptor antibody mapatumumab and a small-molecule antagonist of inhibitor-of-apoptosis proteins. In addition, HGS has substantial financial rights to certain products in the GSK clinical pipeline including darapladib, currently in Phase 3 development in patients with coronary heart disease, and Syncria® (albiglutide), currently in Phase 3 development in patients with type 2 diabetes.
For more information about HGS, please visit the Company’s web site at www.hgsi.com. Health professionals and patients interested in clinical trials of HGS products may inquire via e-mail to medinfo@hgsi.comThis e-mail address is being protected from spam bots, you need JavaScript enabled to view it or by calling HGS at (877) 822-8472.
For an Electronic Press Kit on this announcement, please click here.
Safe Harbor Statement
This announcement contains forward-looking statements within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended. The forward-looking statements are based on Human Genome Sciences’ current intent, belief and expectations. These statements are not guarantees of future performance and are subject to certain risks and uncertainties that are difficult to predict. Actual results may differ materially from these forward-looking statements because of Human Genome Sciences’ unproven business model, its dependence on new technologies, the uncertainty and timing of clinical trials, Human Genome Sciences’ ability to develop and commercialize products, its dependence on collaborators for services and revenue, its substantial indebtedness and lease obligations, its changing requirements and costs associated with facilities, intense competition, the uncertainty of patent and intellectual property protection, Human Genome Sciences’ dependence on key management and key suppliers, the uncertainty of regulation of products, the impact of future alliances or transactions and other risks described in the Company’s filings with the SEC. Existing and prospective investors are cautioned not to place undue reliance on these forward-looking statements, which speak only as of today’s date. Human Genome Sciences undertakes no obligation to update or revise the information contained in this announcement whether as a result of new information, future events or circumstances or otherwise.
###
Media Contact:
Jerry Parrott
Vice President, Corporate Communications
301-315-2777
Investor Contact:
Peter Vozzo
Senior Director, Investor Relations
301-251-6003
ROCKVILLE, Maryland – November 25, 2009 – Human Genome Sciences, Inc. (Nasdaq: HGSI) today announced that it has submitted a Biologics License Application (BLA) to the U.S. Food and Drug Administration (FDA) for ZALBIN™ (albinterferon alfa-2b) for the treatment of chronic hepatitis C. The BLA submission includes the results of two pivotal Phase 3 clinical trials showing that 900-mcg albinterferon alfa-2b dosed every two weeks met its primary endpoint of non-inferiority to peginterferon alfa-2a (Pegasys) dosed once each week.
The Phase 3 studies, known as ACHIEVE 1 and ACHIEVE 2/3, evaluated albinterferon alfa-2b vs. peginterferon alfa-2a, in combination with ribavirin, for use in the treatment of interferon-naïve patients with chronic hepatitis C. In both studies, albinterferon alfa-2b, with half the injections, achieved sustained virologic response comparable to that achieved by peginterferon alfa-2a. The rates of serious and/or severe adverse events were also comparable in these studies. ACHIEVE 1 was conducted in patients infected with genotype 1 virus, and ACHIEVE 2/3 was conducted in patients with genotypes 2 or 3 virus. The two studies treated a total of 2255 patients.
“We look forward to continuing to work closely with Novartis to advance albinterferon alfa-2b to the market under the brand name ZALBIN in the United States,” said H. Thomas Watkins, President and Chief Executive Officer, HGS. “Assuming licensure by the FDA and other regulatory agencies, HGS believes ZALBIN could become an important treatment for chronic hepatitis C. Novartis targets submission of marketing authorization applications under the brand name JOULFERON® in the rest of the world later this quarter, beginning with Europe.”
About the Collaboration with Novartis
Under an exclusive worldwide co-development and commercialization agreement entered into in 2006, HGS and Novartis will co-commercialize albinterferon alfa-2b in the United States as ZALBIN™, and will share clinical development costs, U.S. commercialization costs and U.S. profits equally. Novartis will be responsible for commercialization of albinterferon alfa-2b as JOULFERON® in the rest of the world, and will pay HGS a royalty on those sales. These brand names will be subject to confirmation by health authorities at the time of product approval.
HGS has primary responsibility for the bulk manufacture of albinterferon alfa-2b, and Novartis will have responsibility for commercial manufacturing of the finished drug product. Clinical development, commercial milestone and other payments to HGS could total as much as $507.5 million, including $207.5 million received to date. The remaining payments to HGS under the agreement relate to the achievement of certain regulatory approval and commercial milestones.
About ZALBIN (albinterferon alfa-2b)
ZALBIN (also known as JOULFERON) is a genetic fusion of human albumin and interferon alfa created using proprietary HGS albumin-fusion technology. Human albumin is the most prevalent naturally occurring blood protein in the human circulatory system, persisting in circulation in the body for approximately 19 days. Research has shown that genetic fusion of therapeutic proteins to human albumin decreases clearance and prolongs the half-life of the therapeutic proteins.
ZALBIN dosed once every two weeks has completed Phase 3 development. In April 2009, positive Phase 3 results of ZALBIN in patients with chronic hepatitis C were presented at the 44th annual meeting of the European Association for the Study of the Liver in Copenhagen. Data from two pivotal Phase 3 trials, ACHIEVE 1 and ACHIEVE 2/3, showed that ZALBIN met its primary endpoint of non-inferiority to Pegasys (peginterferon alfa-2a). With half the injections, ZALBIN achieved a rate of sustained virologic response comparable to Pegasys in these studies; rates of serious and/or severe adverse events were also comparable.
About Hepatitis C
Hepatitis C is an inflammation of the liver caused by the hepatitis C virus. It is estimated that as many as 170 million people worldwide are infected with hepatitis C virus. This includes nearly four million people in the United States. When detectable levels of HCV persist in the blood for at least six months, a person is diagnosed with chronic hepatitis C. Hepatitis C virus can cause serious liver disease, leading to cirrhosis, primary liver cancer and even death. Patients infected with the genotype 1 hepatitis C virus account for approximately 75% of the chronic hepatitis C patients in the U.S.
About Human Genome Sciences
The mission of HGS is to apply great science and great medicine to bring innovative drugs to patients with unmet medical needs. The HGS clinical development pipeline includes novel drugs to treat lupus, hepatitis C, inhalation anthrax and cancer.
The Company’s primary focus is rapid progress toward the commercialization of its two lead drugs, BENLYSTA™ (belimumab) for lupus and ZALBIN™ (albinterferon alfa-2b) for hepatitis C. Phase 3 development has been completed successfully for both BENLYSTA and Zalbin. The submission of marketing applications for BENLYSTA is planned in the U.S., Europe and other regions in the first half of 2010. A BLA has been submitted for ZALBIN to the FDA in the United States, and Novartis targets submission of marketing authorization applications under the brand name JOULFERON® in the rest of the world, beginning with Europe in fourth quarter 2009.
In April 2009, HGS completed the delivery of 20,000 doses of raxibacumab to the U.S. Strategic National Stockpile for use in the event of an emergency to treat inhalational anthrax. In July 2009, HGS secured a new purchase order for 45,000 doses of raxibacumab to be delivered to the Stockpile over a three-year period beginning near the end of 2009. In May 2009, HGS submitted a Biologics License Application to the FDA for raxibacumab for the treatment of inhalation anthrax.
The Company also has several drugs in earlier stages of clinical development for the treatment of cancer, led by the TRAIL receptor antibody mapatumumab and a small-molecule antagonist of inhibitor-of-apoptosis proteins. In addition, HGS has substantial financial rights to certain products in the GSK clinical pipeline including darapladib, currently in Phase 3 development in patients with coronary heart disease, and Syncria® (albiglutide), currently in Phase 3 development in patients with type 2 diabetes.
For more information about HGS, please visit the Company’s web site at www.hgsi.com. Health professionals and patients interested in clinical trials of HGS products may inquire via e-mail to medinfo@hgsi.comThis e-mail address is being protected from spam bots, you need JavaScript enabled to view it or by calling HGS at (877) 822-8472.
For an Electronic Press Kit on this announcement, please click here.
Safe Harbor Statement
This announcement contains forward-looking statements within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E of the Securities Exchange Act of 1934, as amended. The forward-looking statements are based on Human Genome Sciences’ current intent, belief and expectations. These statements are not guarantees of future performance and are subject to certain risks and uncertainties that are difficult to predict. Actual results may differ materially from these forward-looking statements because of Human Genome Sciences’ unproven business model, its dependence on new technologies, the uncertainty and timing of clinical trials, Human Genome Sciences’ ability to develop and commercialize products, its dependence on collaborators for services and revenue, its substantial indebtedness and lease obligations, its changing requirements and costs associated with facilities, intense competition, the uncertainty of patent and intellectual property protection, Human Genome Sciences’ dependence on key management and key suppliers, the uncertainty of regulation of products, the impact of future alliances or transactions and other risks described in the Company’s filings with the SEC. Existing and prospective investors are cautioned not to place undue reliance on these forward-looking statements, which speak only as of today’s date. Human Genome Sciences undertakes no obligation to update or revise the information contained in this announcement whether as a result of new information, future events or circumstances or otherwise.
###
Media Contact:
Jerry Parrott
Vice President, Corporate Communications
301-315-2777
Investor Contact:
Peter Vozzo
Senior Director, Investor Relations
301-251-6003
Subscribe to:
Posts (Atom)
.jpg)
